CU151322 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGGGGAGAAAAATAGATTTGTAGTTAGTAAAAAGAAGGACCGGTCTTTAACGTCTCCAGCGTATAAGAGACATGCAGCTACGGAGCAATCTGGCAGTTCTAACTT
BLAST of CU151322 vs. TrEMBL
Match: A0A0A0LH28_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G812770 PE=4 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 2.5e-08 Identity = 31/32 (96.88%), Postives = 32/32 (100.00%), Query Frame = 3
BLAST of CU151322 vs. NCBI nr
Match: gi|778684966|ref|XP_004136597.2| (PREDICTED: zinc finger protein VAR3, chloroplastic [Cucumis sativus]) HSP 1 Score: 60.5 bits (145), Expect = 6.7e-07 Identity = 31/32 (96.88%), Postives = 32/32 (100.00%), Query Frame = 3
BLAST of CU151322 vs. NCBI nr
Match: gi|659084929|ref|XP_008443149.1| (PREDICTED: zinc finger protein VAR3, chloroplastic [Cucumis melo]) HSP 1 Score: 58.2 bits (139), Expect = 3.3e-06 Identity = 30/32 (93.75%), Postives = 31/32 (96.88%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|