CU151295 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGTAAATTTAGAACTTTATCGAAATATCCAATTTATGTTTTTATTTACAAAAATCTGAATCTCAATACACAAATCATTGTTAGTTCAAACGATTTTCCCCGATAGACTTTGGGTGCCAGAAATCAAATTCAAATATTTCTCAACAGTCATCTCTGGTGAGTAATCAGTAAAATATCCATTCTCAACTTCTAACCCCGAATTGGGCCGCAACAATCTCCACATGTCTCTGAACTCG
BLAST of CU151295 vs. TrEMBL
Match: A0A0A0KAE4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G124100 PE=4 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 6.7e-09 Identity = 32/33 (96.97%), Postives = 32/33 (96.97%), Query Frame = -2
BLAST of CU151295 vs. NCBI nr
Match: gi|449444392|ref|XP_004139959.1| (PREDICTED: formimidoyltransferase-cyclodeaminase-like [Cucumis sativus]) HSP 1 Score: 68.9 bits (167), Expect = 4.3e-09 Identity = 32/33 (96.97%), Postives = 32/33 (96.97%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|