CU150526 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTCAAACAAATCAATATAATCAGACTATTAGAAGGAAGTCAAACCGTTAAACTAATTTACAAACAAATAAACAAACTTTACATAACTAAATAGAAGAAAAATAAAAAGAAGTTGACAACAAAATAAAACAAGTTCTCCAAAAGACTTCAAGCTGCAACTCCTCTACTATTCAAAGCTCTCTCCAACCTTGTTTCAAATGGTGTGGAGTGCCACTTCACTGTCTTATCCTCTCGATACT
BLAST of CU150526 vs. TrEMBL
Match: A0A0A0KF36_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G088090 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.3e-07 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = -3
BLAST of CU150526 vs. NCBI nr
Match: gi|778711651|ref|XP_011656777.1| (PREDICTED: uncharacterized protein LOC101205962 isoform X1 [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 1.4e-07 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = -3
BLAST of CU150526 vs. NCBI nr
Match: gi|449445626|ref|XP_004140573.1| (PREDICTED: uncharacterized protein LOC101205962 isoform X2 [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 1.4e-07 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = -3
BLAST of CU150526 vs. NCBI nr
Match: gi|659119987|ref|XP_008459951.1| (PREDICTED: uncharacterized protein LOC103498917 isoform X1 [Cucumis melo]) HSP 1 Score: 62.0 bits (149), Expect = 5.3e-07 Identity = 28/29 (96.55%), Postives = 28/29 (96.55%), Query Frame = -3
BLAST of CU150526 vs. NCBI nr
Match: gi|659119989|ref|XP_008459952.1| (PREDICTED: uncharacterized protein LOC103498917 isoform X2 [Cucumis melo]) HSP 1 Score: 62.0 bits (149), Expect = 5.3e-07 Identity = 28/29 (96.55%), Postives = 28/29 (96.55%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|