CU150359 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGATTCCATTATGGAGGTTAAGGGCCGTGCAGTTTCCACTTTAGTCTCTCGCCTCAGCTAACCGTACTACCGAAGACAAAATACCGATGCGAATCCTTGTCCGAGCTTCGATTGATGACCAAAAACGACGCCCAAAGCCGTTCTCTCATCGTCCATGCCGGTGCTCTTCCTTATTTGTC
BLAST of CU150359 vs. TrEMBL
Match: A0A0A0KDY4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G401390 PE=4 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 7.4e-08 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of CU150359 vs. TrEMBL
Match: A0A0A0KDY4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G401390 PE=4 SV=1) HSP 1 Score: 32.3 bits (72), Expect = 2.4e+02 Identity = 16/16 (100.00%), Postives = 16/16 (100.00%), Query Frame = 2
BLAST of CU150359 vs. NCBI nr
Match: gi|449458065|ref|XP_004146768.1| (PREDICTED: protein spotted leaf 11 [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 1.1e-07 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of CU150359 vs. NCBI nr
Match: gi|659089251|ref|XP_008445408.1| (PREDICTED: protein spotted leaf 11 [Cucumis melo]) HSP 1 Score: 58.2 bits (139), Expect = 5.8e-06 Identity = 28/31 (90.32%), Postives = 29/31 (93.55%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|