CU150244 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACATGAACCCTACATTCTCCGTTCTCATTTGGAGGGATACTCCCTTTTGGGGCAGTCTTTATTGAGCTGTTTTTCATCCTTACCTCCATATGGTTGCACCAATTTTACTACATCTTTGGTTTCCTCTTCATTGTGTTCCTCATCCTGATAGTCACTTGCGCTGAGATCACAATTGTGCTCTGCTACTTCCAACTGTGCAGTGAGACTACA
BLAST of CU150244 vs. Swiss-Prot
Match: TMN10_ARATH (Transmembrane 9 superfamily member 10 OS=Arabidopsis thaliana GN=TMN10 PE=2 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 2.1e-15 Identity = 40/58 (68.97%), Postives = 39/58 (67.24%), Query Frame = 1
BLAST of CU150244 vs. Swiss-Prot
Match: TMN9_ARATH (Transmembrane 9 superfamily member 9 OS=Arabidopsis thaliana GN=TMN9 PE=2 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.1e-14 Identity = 40/58 (68.97%), Postives = 39/58 (67.24%), Query Frame = 1
BLAST of CU150244 vs. Swiss-Prot
Match: TMN6_ARATH (Transmembrane 9 superfamily member 6 OS=Arabidopsis thaliana GN=TMN6 PE=2 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.1e-14 Identity = 40/58 (68.97%), Postives = 39/58 (67.24%), Query Frame = 1
BLAST of CU150244 vs. Swiss-Prot
Match: TMN8_ARATH (Transmembrane 9 superfamily member 8 OS=Arabidopsis thaliana GN=TMN8 PE=2 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.4e-14 Identity = 39/58 (67.24%), Postives = 39/58 (67.24%), Query Frame = 1
BLAST of CU150244 vs. Swiss-Prot
Match: TMN7_ARATH (Transmembrane 9 superfamily member 7 OS=Arabidopsis thaliana GN=TMN7 PE=2 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.4e-14 Identity = 39/58 (67.24%), Postives = 39/58 (67.24%), Query Frame = 1
BLAST of CU150244 vs. TrEMBL
Match: A0A0D2U4Y3_GOSRA (Transmembrane 9 superfamily member OS=Gossypium raimondii GN=B456_013G215900 PE=3 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.7e-14 Identity = 44/67 (65.67%), Postives = 45/67 (67.16%), Query Frame = 1
BLAST of CU150244 vs. TrEMBL
Match: A0A0B0NI98_GOSAR (Transmembrane 9 superfamily member OS=Gossypium arboreum GN=F383_18064 PE=3 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.7e-14 Identity = 44/67 (65.67%), Postives = 45/67 (67.16%), Query Frame = 1
BLAST of CU150244 vs. TrEMBL
Match: M5VWG0_PRUPE (Transmembrane 9 superfamily member OS=Prunus persica GN=PRUPE_ppa002742mg PE=3 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 8.2e-14 Identity = 44/67 (65.67%), Postives = 46/67 (68.66%), Query Frame = 1
BLAST of CU150244 vs. TrEMBL
Match: V7B1P7_PHAVU (Transmembrane 9 superfamily member OS=Phaseolus vulgaris GN=PHAVU_009G204800g PE=3 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.1e-13 Identity = 44/67 (65.67%), Postives = 46/67 (68.66%), Query Frame = 1
BLAST of CU150244 vs. TrEMBL
Match: A0A151T065_CAJCA (Transmembrane 9 superfamily member OS=Cajanus cajan GN=KK1_022849 PE=3 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.1e-13 Identity = 44/67 (65.67%), Postives = 46/67 (68.66%), Query Frame = 1
BLAST of CU150244 vs. NCBI nr
Match: gi|823259072|ref|XP_012462237.1| (PREDICTED: transmembrane 9 superfamily member 10-like isoform X1 [Gossypium raimondii]) HSP 1 Score: 83.2 bits (204), Expect = 2.0e-13 Identity = 44/67 (65.67%), Postives = 45/67 (67.16%), Query Frame = 1
BLAST of CU150244 vs. NCBI nr
Match: gi|823259074|ref|XP_012462238.1| (PREDICTED: transmembrane 9 superfamily member 10-like isoform X2 [Gossypium raimondii]) HSP 1 Score: 83.2 bits (204), Expect = 2.0e-13 Identity = 44/67 (65.67%), Postives = 45/67 (67.16%), Query Frame = 1
BLAST of CU150244 vs. NCBI nr
Match: gi|728832909|gb|KHG12352.1| (Putative phagocytic receptor 1a [Gossypium arboreum]) HSP 1 Score: 83.2 bits (204), Expect = 2.0e-13 Identity = 44/67 (65.67%), Postives = 45/67 (67.16%), Query Frame = 1
BLAST of CU150244 vs. NCBI nr
Match: gi|658063658|ref|XP_008367749.1| (PREDICTED: transmembrane 9 superfamily member 4-like [Malus domestica]) HSP 1 Score: 82.8 bits (203), Expect = 2.6e-13 Identity = 44/67 (65.67%), Postives = 45/67 (67.16%), Query Frame = 1
BLAST of CU150244 vs. NCBI nr
Match: gi|694380054|ref|XP_009366179.1| (PREDICTED: transmembrane 9 superfamily member 4-like [Pyrus x bretschneideri]) HSP 1 Score: 82.8 bits (203), Expect = 2.6e-13 Identity = 44/67 (65.67%), Postives = 45/67 (67.16%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|