CU149533 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAAACATAAACAGGAACTAAAGTAAGAAAATCAGCTTCAGAAGGGTCCAAAGTCCTTACATGGCTCGTCAAAAGAGCCTTATGAATGGCCACCTCAGAAGCAAACAAATGACCACCGCACCGGGCGTCAGAAAGCCAATTGGCGTTGAATTCGGGCGGCAAGTCGTAGACGAAAACTTTCAAGTCGTTGGTATTGCCATAATAATCAAAAGTGGATTCAACAAGAGCTTTTGAAGGAAGGATT
BLAST of CU149533 vs. Swiss-Prot
Match: F8H_ARATH (Probable glucuronoxylan glucuronosyltransferase F8H OS=Arabidopsis thaliana GN=F8H PE=2 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.8e-16 Identity = 45/83 (54.22%), Postives = 58/83 (69.88%), Query Frame = -2
BLAST of CU149533 vs. Swiss-Prot
Match: IRX7_ARATH (Probable glucuronoxylan glucuronosyltransferase IRX7 OS=Arabidopsis thaliana GN=IRX7 PE=2 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 3.5e-14 Identity = 39/64 (60.94%), Postives = 47/64 (73.44%), Query Frame = -2
BLAST of CU149533 vs. Swiss-Prot
Match: GT13_ORYSJ (Probable glucuronosyltransferase Os01g0926400 OS=Oryza sativa subsp. japonica GN=Os01g0926400 PE=2 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 3.1e-10 Identity = 33/63 (52.38%), Postives = 44/63 (69.84%), Query Frame = -2
BLAST of CU149533 vs. Swiss-Prot
Match: GT31_ORYSJ (Probable glucuronosyltransferase Os03g0107900 OS=Oryza sativa subsp. japonica GN=Os03g0107900 PE=2 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 5.3e-10 Identity = 33/61 (54.10%), Postives = 41/61 (67.21%), Query Frame = -2
BLAST of CU149533 vs. Swiss-Prot
Match: GT101_ORYSJ (Probable glucuronosyltransferase GUT1 OS=Oryza sativa subsp. japonica GN=GUT1 PE=2 SV=2) HSP 1 Score: 63.5 bits (153), Expect = 1.2e-09 Identity = 30/60 (50.00%), Postives = 44/60 (73.33%), Query Frame = -2
BLAST of CU149533 vs. TrEMBL
Match: A0A0A0LS67_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G095020 PE=4 SV=1) HSP 1 Score: 154.1 bits (388), Expect = 7.3e-35 Identity = 75/78 (96.15%), Postives = 75/78 (96.15%), Query Frame = -2
BLAST of CU149533 vs. TrEMBL
Match: I1LTN1_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_12G178100 PE=4 SV=1) HSP 1 Score: 99.8 bits (247), Expect = 1.6e-18 Identity = 49/77 (63.64%), Postives = 59/77 (76.62%), Query Frame = -2
BLAST of CU149533 vs. TrEMBL
Match: I1M4G9_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_13G322400 PE=4 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 2.1e-18 Identity = 48/76 (63.16%), Postives = 59/76 (77.63%), Query Frame = -2
BLAST of CU149533 vs. TrEMBL
Match: A0A0B2QP42_GLYSO (Putative glucuronoxylan glucuronosyltransferase IRX7 OS=Glycine soja GN=glysoja_021067 PE=4 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 2.1e-18 Identity = 48/76 (63.16%), Postives = 59/76 (77.63%), Query Frame = -2
BLAST of CU149533 vs. TrEMBL
Match: V7AFK6_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_011G085300g PE=4 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.4e-17 Identity = 46/66 (69.70%), Postives = 54/66 (81.82%), Query Frame = -2
BLAST of CU149533 vs. NCBI nr
Match: gi|449459136|ref|XP_004147302.1| (PREDICTED: probable glucuronoxylan glucuronosyltransferase F8H [Cucumis sativus]) HSP 1 Score: 156.8 bits (395), Expect = 1.6e-35 Identity = 75/78 (96.15%), Postives = 75/78 (96.15%), Query Frame = -2
BLAST of CU149533 vs. NCBI nr
Match: gi|659072092|ref|XP_008463382.1| (PREDICTED: probable glucuronoxylan glucuronosyltransferase F8H [Cucumis melo]) HSP 1 Score: 149.1 bits (375), Expect = 3.4e-33 Identity = 70/78 (89.74%), Postives = 74/78 (94.87%), Query Frame = -2
BLAST of CU149533 vs. NCBI nr
Match: gi|950958336|ref|XP_014497235.1| (PREDICTED: probable glucuronoxylan glucuronosyltransferase IRX7 [Vigna radiata var. radiata]) HSP 1 Score: 104.0 bits (258), Expect = 1.3e-19 Identity = 48/76 (63.16%), Postives = 61/76 (80.26%), Query Frame = -2
BLAST of CU149533 vs. NCBI nr
Match: gi|356541948|ref|XP_003539434.1| (PREDICTED: probable glucuronoxylan glucuronosyltransferase IRX7 [Glycine max]) HSP 1 Score: 102.1 bits (253), Expect = 4.8e-19 Identity = 49/77 (63.64%), Postives = 59/77 (76.62%), Query Frame = -2
BLAST of CU149533 vs. NCBI nr
Match: gi|734376924|gb|KHN21487.1| (Putative glucuronoxylan glucuronosyltransferase IRX7 [Glycine soja]) HSP 1 Score: 101.7 bits (252), Expect = 6.2e-19 Identity = 48/76 (63.16%), Postives = 59/76 (77.63%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|