CU149459 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACGGTGGAATTTCTTCCAAATCGTCGTCCGAACACGCTTGCCGTAGAATCGGCCACCGACGTTCTTGGGATTGACCTCCATTTTTCCCCGGAAAAATGCGAATATGTCTCTCCGGCGGCCGTCAACGACGGCGGGTTCCATGAATTCCGGCGAAAATATAAGGTGGTATTAAAATATTCTCAACATCTTGACATGGGTGCTTATATTTGACTCCAAAAGTCTGTAAAATGATTGAGTTCTTCAAGAATTCCGGTATTCCGTTCGCTATTGCCATATCTTCCAAGGA
BLAST of CU149459 vs. Swiss-Prot
Match: F8H_ARATH (Probable glucuronoxylan glucuronosyltransferase F8H OS=Arabidopsis thaliana GN=F8H PE=2 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 7.1e-14 Identity = 33/44 (75.00%), Postives = 40/44 (90.91%), Query Frame = -1
HSP 2 Score: 65.9 bits (159), Expect = 2.8e-10 Identity = 33/45 (73.33%), Postives = 35/45 (77.78%), Query Frame = -2
BLAST of CU149459 vs. Swiss-Prot
Match: IRX7_ARATH (Probable glucuronoxylan glucuronosyltransferase IRX7 OS=Arabidopsis thaliana GN=IRX7 PE=2 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 1.0e-12 Identity = 31/44 (70.45%), Postives = 38/44 (86.36%), Query Frame = -1
HSP 2 Score: 61.2 bits (147), Expect = 6.9e-09 Identity = 24/37 (64.86%), Postives = 29/37 (78.38%), Query Frame = -2
BLAST of CU149459 vs. Swiss-Prot
Match: GT31_ORYSJ (Probable glucuronosyltransferase Os03g0107900 OS=Oryza sativa subsp. japonica GN=Os03g0107900 PE=2 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.4e-09 Identity = 26/43 (60.47%), Postives = 36/43 (83.72%), Query Frame = -1
HSP 2 Score: 59.7 bits (143), Expect = 2.0e-08 Identity = 25/36 (69.44%), Postives = 30/36 (83.33%), Query Frame = -2
BLAST of CU149459 vs. TrEMBL
Match: A0A0A0LS67_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G095020 PE=4 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 2.5e-21 Identity = 50/50 (100.00%), Postives = 50/50 (100.00%), Query Frame = -2
BLAST of CU149459 vs. TrEMBL
Match: A0A0A0LS67_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G095020 PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 1.4e-16 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = -1
HSP 2 Score: 82.8 bits (203), Expect = 2.5e-13 Identity = 37/44 (84.09%), Postives = 41/44 (93.18%), Query Frame = -1
BLAST of CU149459 vs. TrEMBL
Match: A0A061GYW4_THECC (Exostosin family protein OS=Theobroma cacao GN=TCM_042153 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 5.9e-07 Identity = 27/46 (58.70%), Postives = 36/46 (78.26%), Query Frame = -2
HSP 2 Score: 81.6 bits (200), Expect = 5.5e-13 Identity = 36/44 (81.82%), Postives = 40/44 (90.91%), Query Frame = -1
BLAST of CU149459 vs. TrEMBL
Match: A0A0B0NXM5_GOSAR (Putative glucuronoxylan glucuronosyltransferase IRX7-like protein OS=Gossypium arboreum GN=F383_24279 PE=4 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 2.9e-06 Identity = 27/45 (60.00%), Postives = 34/45 (75.56%), Query Frame = -2
HSP 2 Score: 81.6 bits (200), Expect = 5.5e-13 Identity = 36/44 (81.82%), Postives = 40/44 (90.91%), Query Frame = -1
BLAST of CU149459 vs. TrEMBL
Match: A0A0D2THS0_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_009G111000 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 5.9e-07 Identity = 28/45 (62.22%), Postives = 35/45 (77.78%), Query Frame = -2
HSP 2 Score: 81.3 bits (199), Expect = 7.2e-13 Identity = 36/42 (85.71%), Postives = 40/42 (95.24%), Query Frame = -1
BLAST of CU149459 vs. NCBI nr
Match: gi|449459136|ref|XP_004147302.1| (PREDICTED: probable glucuronoxylan glucuronosyltransferase F8H [Cucumis sativus]) HSP 1 Score: 111.3 bits (277), Expect = 9.3e-22 Identity = 50/50 (100.00%), Postives = 50/50 (100.00%), Query Frame = -2
BLAST of CU149459 vs. NCBI nr
Match: gi|659072092|ref|XP_008463382.1| (PREDICTED: probable glucuronoxylan glucuronosyltransferase F8H [Cucumis melo]) HSP 1 Score: 94.4 bits (233), Expect = 1.2e-16 Identity = 43/50 (86.00%), Postives = 44/50 (88.00%), Query Frame = -2
BLAST of CU149459 vs. NCBI nr
Match: gi|747082895|ref|XP_011088792.1| (PREDICTED: probable glucuronoxylan glucuronosyltransferase IRX7 [Sesamum indicum]) HSP 1 Score: 84.7 bits (208), Expect = 9.3e-14 Identity = 34/44 (77.27%), Postives = 44/44 (100.00%), Query Frame = -1
BLAST of CU149459 vs. NCBI nr
Match: gi|590590908|ref|XP_007016868.1| (Exostosin family protein [Theobroma cacao]) HSP 1 Score: 84.3 bits (207), Expect = 1.2e-13 Identity = 37/44 (84.09%), Postives = 41/44 (93.18%), Query Frame = -1
BLAST of CU149459 vs. NCBI nr
Match: gi|728839800|gb|KHG19243.1| (putative glucuronoxylan glucuronosyltransferase IRX7 -like protein [Gossypium arboreum]) HSP 1 Score: 83.2 bits (204), Expect = 2.7e-13 Identity = 36/44 (81.82%), Postives = 40/44 (90.91%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|