CU149255 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TACTAAAGAGGGTCGGGTTTCTGATGCTTTAGCTAGTTGGAAAGAAGCCTTTTCTGCCGAGGGTTCTAAGAGTTGGAGGCCAAAAGCCCTATAATGTGTTGGCTTACTTCGACCTCTGTGAGAAAGAAGGAGACATCGCCAGCAAGGAGGTTCTAGTTGGATTACTGAGGCAGCCCAAAATATCTTCAAGACAAAACATATGCATCACTCATTGGTTT
BLAST of CU149255 vs. TrEMBL
Match: A0A0A0L6I4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G127020 PE=4 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 3.7e-09 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = 3
BLAST of CU149255 vs. TrEMBL
Match: A0A0A0L6I4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G127020 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 5.8e-07 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = 2
HSP 2 Score: 32.7 bits (73), Expect = 2.2e+02 Identity = 14/14 (100.00%), Postives = 14/14 (100.00%), Query Frame = 1
BLAST of CU149255 vs. NCBI nr
Match: gi|449432307|ref|XP_004133941.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g02150 [Cucumis sativus]) HSP 1 Score: 70.5 bits (171), Expect = 1.4e-09 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = 3
BLAST of CU149255 vs. NCBI nr
Match: gi|659075585|ref|XP_008438222.1| (PREDICTED: pentatricopeptide repeat-containing protein At1g02150 [Cucumis melo]) HSP 1 Score: 68.9 bits (167), Expect = 4.0e-09 Identity = 31/32 (96.88%), Postives = 31/32 (96.88%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|