CU148755 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATTGCTTAACAAACAAGTAATTAGATCTTGGTGTGAGGAGCCTCCTTTTTCTTCTAATTCAACTCTCTTTTCATCCAACAATTCCTTCAGCATCTCTTGAATTTTTCTACTCGCACGCCGGCTTTGGTTGTACCTTGTGAACGGCAAGTTTATCGGGATCGACCATACTCCGAACTTTCATTACTCGAAAGCATTCTATCATTCTTTCTCTTCTCGTACCTTGCTCAAAGACCAAACAG
BLAST of CU148755 vs. Swiss-Prot
Match: C16B1_PICSI (Cytochrome P450 716B1 OS=Picea sitchensis GN=CYP716B1 PE=2 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.2e-07 Identity = 25/57 (43.86%), Postives = 38/57 (66.67%), Query Frame = -3
BLAST of CU148755 vs. Swiss-Prot
Match: C16B2_PICSI (Cytochrome P450 716B2 OS=Picea sitchensis GN=CYP716B2 PE=2 SV=1) HSP 1 Score: 55.1 bits (131), Expect = 4.1e-07 Identity = 25/57 (43.86%), Postives = 38/57 (66.67%), Query Frame = -3
BLAST of CU148755 vs. TrEMBL
Match: A0A0A0LA02_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G186690 PE=3 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.9e-23 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = -3
BLAST of CU148755 vs. TrEMBL
Match: A0A0A0LA02_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G186690 PE=3 SV=1) HSP 1 Score: 37.0 bits (84), Expect = 1.3e+01 Identity = 16/16 (100.00%), Postives = 16/16 (100.00%), Query Frame = -2
HSP 2 Score: 86.3 bits (212), Expect = 1.9e-14 Identity = 41/56 (73.21%), Postives = 48/56 (85.71%), Query Frame = -3
BLAST of CU148755 vs. TrEMBL
Match: A0A067KSB1_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_00863 PE=3 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 4.1e-14 Identity = 38/56 (67.86%), Postives = 48/56 (85.71%), Query Frame = -3
BLAST of CU148755 vs. TrEMBL
Match: A0A061FD55_THECC (Cytochrome P450 OS=Theobroma cacao GN=TCM_030948 PE=3 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 7.1e-14 Identity = 38/56 (67.86%), Postives = 48/56 (85.71%), Query Frame = -3
BLAST of CU148755 vs. TrEMBL
Match: W9QXR6_9ROSA (Cytochrome P450 OS=Morus notabilis GN=L484_017820 PE=3 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 9.2e-14 Identity = 37/57 (64.91%), Postives = 51/57 (89.47%), Query Frame = -3
BLAST of CU148755 vs. NCBI nr
Match: gi|449446129|ref|XP_004140824.1| (PREDICTED: cytochrome P450 716B1-like [Cucumis sativus]) HSP 1 Score: 115.9 bits (289), Expect = 3.1e-23 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = -3
BLAST of CU148755 vs. NCBI nr
Match: gi|659114553|ref|XP_008457111.1| (PREDICTED: cytochrome P450 716B1-like [Cucumis melo]) HSP 1 Score: 115.9 bits (289), Expect = 3.1e-23 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = -3
BLAST of CU148755 vs. NCBI nr
Match: gi|1012201675|ref|XP_015973365.1| (PREDICTED: taxadiene 5-alpha hydroxylase-like [Arachis duranensis]) HSP 1 Score: 87.8 bits (216), Expect = 9.2e-15 Identity = 39/55 (70.91%), Postives = 48/55 (87.27%), Query Frame = -3
BLAST of CU148755 vs. NCBI nr
Match: gi|1021552062|ref|XP_016167373.1| (PREDICTED: taxadiene 5-alpha hydroxylase-like [Arachis ipaensis]) HSP 1 Score: 87.8 bits (216), Expect = 9.2e-15 Identity = 39/55 (70.91%), Postives = 48/55 (87.27%), Query Frame = -3
BLAST of CU148755 vs. NCBI nr
Match: gi|297737414|emb|CBI26615.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 87.4 bits (215), Expect = 1.2e-14 Identity = 41/56 (73.21%), Postives = 48/56 (85.71%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|