CU148622 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAGAGTTGATGATCAGAGTGATATGAAAAGAAGAAAGTTTGAACAAAAAGATCACAAGGAACTGATTTCATTAGTACGTAGTAGCTCTTCCTCATTGACTGCCCAACTGGATGCTAGTTATTATTTTACTAGTCAGCACAAGAGAAAACTGAGAAGCCTTGCTCCAGGTCCAGTCAATGACCAACTTTTTGTTACTAGAAGATGGTACACAGTGACCAAACAATCTAACAAGTGCTTGATGTTGGG
BLAST of CU148622 vs. TrEMBL
Match: A0A0A0LRK6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G000560 PE=4 SV=1) HSP 1 Score: 120.2 bits (300), Expect = 1.2e-24 Identity = 60/65 (92.31%), Postives = 60/65 (92.31%), Query Frame = 3
BLAST of CU148622 vs. TrEMBL
Match: E5GBL5_CUCME (Nucleotide binding protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 7.0e-17 Identity = 48/63 (76.19%), Postives = 52/63 (82.54%), Query Frame = 3
BLAST of CU148622 vs. TrEMBL
Match: V7B030_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_009G161300g PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.8e-09 Identity = 34/56 (60.71%), Postives = 41/56 (73.21%), Query Frame = 3
BLAST of CU148622 vs. TrEMBL
Match: Q9FI51_ARATH (Putative uncharacterized protein OS=Arabidopsis thaliana PE=4 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 9.2e-09 Identity = 34/61 (55.74%), Postives = 40/61 (65.57%), Query Frame = 3
BLAST of CU148622 vs. TrEMBL
Match: M5WGN3_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa004129mg PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.2e-08 Identity = 37/64 (57.81%), Postives = 44/64 (68.75%), Query Frame = 3
BLAST of CU148622 vs. NCBI nr
Match: gi|778655191|ref|XP_011648713.1| (PREDICTED: uncharacterized protein LOC101206361 [Cucumis sativus]) HSP 1 Score: 119.0 bits (297), Expect = 3.8e-24 Identity = 60/65 (92.31%), Postives = 60/65 (92.31%), Query Frame = 3
BLAST of CU148622 vs. NCBI nr
Match: gi|659128775|ref|XP_008464363.1| (PREDICTED: uncharacterized protein LOC103502273 [Cucumis melo]) HSP 1 Score: 112.5 bits (280), Expect = 3.6e-22 Identity = 57/64 (89.06%), Postives = 57/64 (89.06%), Query Frame = 3
BLAST of CU148622 vs. NCBI nr
Match: gi|307136000|gb|ADN33856.1| (nucleotide binding protein [Cucumis melo subsp. melo]) HSP 1 Score: 94.7 bits (234), Expect = 7.7e-17 Identity = 48/63 (76.19%), Postives = 52/63 (82.54%), Query Frame = 3
BLAST of CU148622 vs. NCBI nr
Match: gi|593328850|ref|XP_007137852.1| (hypothetical protein PHAVU_009G161300g [Phaseolus vulgaris]) HSP 1 Score: 69.7 bits (169), Expect = 2.6e-09 Identity = 34/56 (60.71%), Postives = 41/56 (73.21%), Query Frame = 3
BLAST of CU148622 vs. NCBI nr
Match: gi|694396746|ref|XP_009373645.1| (PREDICTED: uncharacterized protein LOC103962631 [Pyrus x bretschneideri]) HSP 1 Score: 69.7 bits (169), Expect = 2.6e-09 Identity = 37/64 (57.81%), Postives = 45/64 (70.31%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|