CU148487 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTAGTTCCAGAGCCATTTGTCTTGTATTTCTTGAGATTTCGCTCCCGTTCCTTCTGTTCAGATCAGTTACACTACTTTTTTAAAAGTTGCTTTCTCAGGTTTCCATACGCTTCCATCTTTATTTTGAATCTTCCGCAGTTGTTGGAACTAGCATTAGTTTTCGAGGCCGTCCTCTCTTTCTTTTGTAACTGTTTTTACTAGCTTGTTGCTGCTCAATTTCCTGCATGATTTTACGAGGCCTTCCCCGCTTTCGTCTATCACTGTTTTCAGTAGC
BLAST of CU148487 vs. TrEMBL
Match: A0A0A0K5U9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G412860 PE=4 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 3.5e-25 Identity = 69/84 (82.14%), Postives = 69/84 (82.14%), Query Frame = -1
BLAST of CU148487 vs. TrEMBL
Match: A0A0A0K5U9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G412860 PE=4 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 2.3e-08 Identity = 46/105 (43.81%), Postives = 56/105 (53.33%), Query Frame = -1
BLAST of CU148487 vs. NCBI nr
Match: gi|778728305|ref|XP_011659404.1| (PREDICTED: uncharacterized protein LOC101218122 isoform X2 [Cucumis sativus]) HSP 1 Score: 115.2 bits (287), Expect = 6.2e-23 Identity = 69/84 (82.14%), Postives = 69/84 (82.14%), Query Frame = -1
BLAST of CU148487 vs. NCBI nr
Match: gi|659101137|ref|XP_008451446.1| (PREDICTED: uncharacterized protein LOC103492739 isoform X2 [Cucumis melo]) HSP 1 Score: 112.8 bits (281), Expect = 3.1e-22 Identity = 68/84 (80.95%), Postives = 68/84 (80.95%), Query Frame = -1
BLAST of CU148487 vs. NCBI nr
Match: gi|778728302|ref|XP_011659403.1| (PREDICTED: uncharacterized protein LOC101218122 isoform X1 [Cucumis sativus]) HSP 1 Score: 102.8 bits (255), Expect = 3.2e-19 Identity = 69/105 (65.71%), Postives = 69/105 (65.71%), Query Frame = -1
BLAST of CU148487 vs. NCBI nr
Match: gi|659101135|ref|XP_008451445.1| (PREDICTED: uncharacterized protein LOC103492739 isoform X1 [Cucumis melo]) HSP 1 Score: 100.5 bits (249), Expect = 1.6e-18 Identity = 68/105 (64.76%), Postives = 68/105 (64.76%), Query Frame = -1
BLAST of CU148487 vs. NCBI nr
Match: gi|778728309|ref|XP_011659405.1| (PREDICTED: uncharacterized protein LOC101218122 isoform X3 [Cucumis sativus]) HSP 1 Score: 68.2 bits (165), Expect = 8.7e-09 Identity = 51/102 (50.00%), Postives = 57/102 (55.88%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|