CU147961 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAGGATCTTAGACCAGAATGGCATAACTGTAACACTGGACAAATGCAATCTCCCATCGATTTGTTGAACCAAAGAGTTCGTATTGTGTCGCATTTTACGGACTTCCAAATCGACTATGGATCTTCAAATGCAACTCTTAAGAATAGAGGGCATGATATAATGTTAAAATGGAGAAGTGCAGCTGGACATATGGAAGTAAATA
BLAST of CU147961 vs. Swiss-Prot
Match: ATCA7_ARATH (Alpha carbonic anhydrase 7 OS=Arabidopsis thaliana GN=ACA7 PE=2 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 1.3e-17 Identity = 40/66 (60.61%), Postives = 47/66 (71.21%), Query Frame = 2
BLAST of CU147961 vs. Swiss-Prot
Match: ATCA2_ARATH (Alpha carbonic anhydrase 2 OS=Arabidopsis thaliana GN=ACA2 PE=2 SV=2) HSP 1 Score: 77.4 bits (189), Expect = 6.6e-14 Identity = 37/66 (56.06%), Postives = 44/66 (66.67%), Query Frame = 2
BLAST of CU147961 vs. Swiss-Prot
Match: NEC3_NICLS (Bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3 OS=Nicotiana langsdorffii x Nicotiana sanderae GN=NEC3 PE=1 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 3.4e-10 Identity = 31/66 (46.97%), Postives = 44/66 (66.67%), Query Frame = 2
BLAST of CU147961 vs. Swiss-Prot
Match: ATCA4_ARATH (Alpha carbonic anhydrase 4 OS=Arabidopsis thaliana GN=ACA4 PE=3 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 5.8e-10 Identity = 29/64 (45.31%), Postives = 38/64 (59.38%), Query Frame = 2
BLAST of CU147961 vs. Swiss-Prot
Match: ATCA5_ARATH (Alpha carbonic anhydrase 5 OS=Arabidopsis thaliana GN=ACA5 PE=3 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 9.8e-10 Identity = 30/55 (54.55%), Postives = 36/55 (65.45%), Query Frame = 2
BLAST of CU147961 vs. TrEMBL
Match: A0A0A0LXW4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G120420 PE=4 SV=1) HSP 1 Score: 143.7 bits (361), Expect = 8.3e-32 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 2
BLAST of CU147961 vs. TrEMBL
Match: A0A0A0LV23_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G120450 PE=4 SV=1) HSP 1 Score: 121.3 bits (303), Expect = 4.4e-25 Identity = 55/65 (84.62%), Postives = 59/65 (90.77%), Query Frame = 2
BLAST of CU147961 vs. TrEMBL
Match: A0A0A0LSD3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G120410 PE=4 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 3.4e-17 Identity = 43/66 (65.15%), Postives = 53/66 (80.30%), Query Frame = 2
BLAST of CU147961 vs. TrEMBL
Match: I1M4I7_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_13G324400 PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 9.9e-17 Identity = 40/66 (60.61%), Postives = 52/66 (78.79%), Query Frame = 2
BLAST of CU147961 vs. TrEMBL
Match: A0A0B2QMS2_GLYSO (Bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3 OS=Glycine soja GN=glysoja_021084 PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 9.9e-17 Identity = 40/66 (60.61%), Postives = 52/66 (78.79%), Query Frame = 2
BLAST of CU147961 vs. NCBI nr
Match: gi|778659157|ref|XP_004139553.2| (PREDICTED: alpha carbonic anhydrase 7-like [Cucumis sativus]) HSP 1 Score: 145.6 bits (366), Expect = 3.1e-32 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 2
BLAST of CU147961 vs. NCBI nr
Match: gi|659071960|ref|XP_008462808.1| (PREDICTED: bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3-like [Cucumis melo]) HSP 1 Score: 134.4 bits (337), Expect = 7.2e-29 Identity = 60/66 (90.91%), Postives = 63/66 (95.45%), Query Frame = 2
BLAST of CU147961 vs. NCBI nr
Match: gi|778659160|ref|XP_011653931.1| (PREDICTED: alpha carbonic anhydrase 7-like [Cucumis sativus]) HSP 1 Score: 123.2 bits (308), Expect = 1.7e-25 Identity = 55/65 (84.62%), Postives = 59/65 (90.77%), Query Frame = 2
BLAST of CU147961 vs. NCBI nr
Match: gi|659071962|ref|XP_008462817.1| (PREDICTED: bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3-like [Cucumis melo]) HSP 1 Score: 123.2 bits (308), Expect = 1.7e-25 Identity = 54/66 (81.82%), Postives = 60/66 (90.91%), Query Frame = 2
BLAST of CU147961 vs. NCBI nr
Match: gi|659071966|ref|XP_008462835.1| (PREDICTED: bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3-like isoform X2 [Cucumis melo]) HSP 1 Score: 102.4 bits (254), Expect = 3.0e-19 Identity = 46/66 (69.70%), Postives = 54/66 (81.82%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|