CU147694 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCATAATAATACACGAGTACATAGGGTATATTTTATATGCAATCGACAAAATGAAGCATGGTGCAGAAGGGGAACAGAGAAAGAAACCTCATTAGACCCAGAAACCAAAATCGGCTCCTTTTGGAAGTCCCTAGAATAGGTCACAGCGTCTTCTTTCTCCAACCACTCCTCACAAATCCCCAATTCCGAAATCCGATCGCCGTCAATGAACCGGGAATTCAAGTCATCGCCTTC
BLAST of CU147694 vs. Swiss-Prot
Match: FUT11_ARATH (Glycoprotein 3-alpha-L-fucosyltransferase A OS=Arabidopsis thaliana GN=FUT11 PE=2 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 5.9e-06 Identity = 20/29 (68.97%), Postives = 24/29 (82.76%), Query Frame = -1
BLAST of CU147694 vs. TrEMBL
Match: A0A0A0L6G6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G206320 PE=4 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 1.1e-19 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -1
BLAST of CU147694 vs. TrEMBL
Match: Q9ST51_VIGRR (Fuct c3 protein OS=Vigna radiata var. radiata GN=fuct PE=2 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 4.0e-09 Identity = 32/49 (65.31%), Postives = 37/49 (75.51%), Query Frame = -1
BLAST of CU147694 vs. TrEMBL
Match: A0A0L9VAP5_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan09g073200 PE=3 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 1.5e-08 Identity = 30/49 (61.22%), Postives = 36/49 (73.47%), Query Frame = -1
BLAST of CU147694 vs. TrEMBL
Match: A0A0S3R363_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.01G276700 PE=3 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 1.5e-08 Identity = 30/49 (61.22%), Postives = 36/49 (73.47%), Query Frame = -1
BLAST of CU147694 vs. TrEMBL
Match: A0A151UD50_CAJCA (Glycoprotein 3-alpha-L-fucosyltransferase A OS=Cajanus cajan GN=KK1_046629 PE=3 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 1.5e-08 Identity = 30/49 (61.22%), Postives = 37/49 (75.51%), Query Frame = -1
BLAST of CU147694 vs. NCBI nr
Match: gi|700202397|gb|KGN57530.1| (hypothetical protein Csa_3G206320 [Cucumis sativus]) HSP 1 Score: 104.4 bits (259), Expect = 9.3e-20 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -1
BLAST of CU147694 vs. NCBI nr
Match: gi|449446089|ref|XP_004140804.1| (PREDICTED: glycoprotein 3-alpha-L-fucosyltransferase A [Cucumis sativus]) HSP 1 Score: 104.4 bits (259), Expect = 9.3e-20 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -1
BLAST of CU147694 vs. NCBI nr
Match: gi|659112246|ref|XP_008456133.1| (PREDICTED: glycoprotein 3-alpha-L-fucosyltransferase A-like [Cucumis melo]) HSP 1 Score: 99.4 bits (246), Expect = 3.0e-18 Identity = 46/48 (95.83%), Postives = 48/48 (100.00%), Query Frame = -1
BLAST of CU147694 vs. NCBI nr
Match: gi|659098635|ref|XP_008450236.1| (PREDICTED: putative fucosyltransferase-like protein [Cucumis melo]) HSP 1 Score: 93.6 bits (231), Expect = 1.6e-16 Identity = 44/52 (84.62%), Postives = 46/52 (88.46%), Query Frame = -1
BLAST of CU147694 vs. NCBI nr
Match: gi|951010448|ref|XP_014509548.1| (PREDICTED: glycoprotein 3-alpha-L-fucosyltransferase A [Vigna radiata var. radiata]) HSP 1 Score: 69.3 bits (168), Expect = 3.3e-09 Identity = 32/49 (65.31%), Postives = 37/49 (75.51%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|