CU146762 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGCCAGAACTGGAAATATCCATTATAAATCTAATGGTGTTATGGACAAAGAGACGTGGGTTCCAAAATTGCAAGCAACACTCTCCAGACTTTCATCTTTTGGTGCTATTAATAACACTGAAAGCATGCACTCCAGATTAGCTTCTCGGGCAAACATCTCCTGTATTGGGAACTTCAAGCCCGATTCGATCATCTGAAGATTTTTCAGAGGATT
BLAST of CU146762 vs. TrEMBL
Match: A0A0A0LHX9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G109700 PE=4 SV=1) HSP 1 Score: 104.4 bits (259), Expect = 5.8e-20 Identity = 51/60 (85.00%), Postives = 52/60 (86.67%), Query Frame = 3
BLAST of CU146762 vs. TrEMBL
Match: A0A0A0LHX9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G109700 PE=4 SV=1) HSP 1 Score: 42.7 bits (99), Expect = 2.1e-01 Identity = 20/20 (100.00%), Postives = 20/20 (100.00%), Query Frame = 1
BLAST of CU146762 vs. NCBI nr
Match: gi|700206274|gb|KGN61393.1| (hypothetical protein Csa_2G109700 [Cucumis sativus]) HSP 1 Score: 105.5 bits (262), Expect = 3.8e-20 Identity = 51/60 (85.00%), Postives = 52/60 (86.67%), Query Frame = 3
BLAST of CU146762 vs. NCBI nr
Match: gi|659082149|ref|XP_008441693.1| (PREDICTED: uncharacterized protein LOC103485768 isoform X2 [Cucumis melo]) HSP 1 Score: 102.4 bits (254), Expect = 3.2e-19 Identity = 48/60 (80.00%), Postives = 52/60 (86.67%), Query Frame = 3
BLAST of CU146762 vs. NCBI nr
Match: gi|659082151|ref|XP_008441694.1| (PREDICTED: uncharacterized protein LOC103485768 isoform X3 [Cucumis melo]) HSP 1 Score: 102.4 bits (254), Expect = 3.2e-19 Identity = 48/60 (80.00%), Postives = 52/60 (86.67%), Query Frame = 3
BLAST of CU146762 vs. NCBI nr
Match: gi|659082153|ref|XP_008441696.1| (PREDICTED: uncharacterized protein LOC103485768 isoform X4 [Cucumis melo]) HSP 1 Score: 102.4 bits (254), Expect = 3.2e-19 Identity = 48/60 (80.00%), Postives = 52/60 (86.67%), Query Frame = 3
BLAST of CU146762 vs. NCBI nr
Match: gi|659082147|ref|XP_008441692.1| (PREDICTED: uncharacterized protein LOC103485768 isoform X1 [Cucumis melo]) HSP 1 Score: 102.4 bits (254), Expect = 3.2e-19 Identity = 48/60 (80.00%), Postives = 52/60 (86.67%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|