CU146670 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTGTTCATATGCTAAGAACAGAGCATATTTCAAGACGTATAGATAAGGATAAATTCTTGCCACTCCTTGCATACGAGGTTAATATTTTCTCATAAATAGTAGATGCTGGGAGGCAGTGGTGTTACTCCTATAAAATAAATTAAAAG
BLAST of CU146670 vs. TrEMBL
Match: A0A0A0KIV2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G045020 PE=4 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 7.3e-06 Identity = 27/30 (90.00%), Postives = 28/30 (93.33%), Query Frame = 3
BLAST of CU146670 vs. NCBI nr
Match: gi|778698196|ref|XP_011654481.1| (PREDICTED: uncharacterized protein LOC101219169 isoform X1 [Cucumis sativus]) HSP 1 Score: 58.2 bits (139), Expect = 4.7e-06 Identity = 27/30 (90.00%), Postives = 28/30 (93.33%), Query Frame = 3
BLAST of CU146670 vs. NCBI nr
Match: gi|700194473|gb|KGN49650.1| (hypothetical protein Csa_5G045020 [Cucumis sativus]) HSP 1 Score: 58.2 bits (139), Expect = 4.7e-06 Identity = 27/30 (90.00%), Postives = 28/30 (93.33%), Query Frame = 3
BLAST of CU146670 vs. NCBI nr
Match: gi|659098640|ref|XP_008450239.1| (PREDICTED: uncharacterized protein LOC103491903 isoform X1 [Cucumis melo]) HSP 1 Score: 58.2 bits (139), Expect = 4.7e-06 Identity = 27/30 (90.00%), Postives = 28/30 (93.33%), Query Frame = 3
BLAST of CU146670 vs. NCBI nr
Match: gi|778698200|ref|XP_011654482.1| (PREDICTED: uncharacterized protein LOC101219169 isoform X2 [Cucumis sativus]) HSP 1 Score: 58.2 bits (139), Expect = 4.7e-06 Identity = 27/30 (90.00%), Postives = 28/30 (93.33%), Query Frame = 3
BLAST of CU146670 vs. NCBI nr
Match: gi|659098644|ref|XP_008450240.1| (PREDICTED: uncharacterized protein LOC103491903 isoform X2 [Cucumis melo]) HSP 1 Score: 58.2 bits (139), Expect = 4.7e-06 Identity = 27/30 (90.00%), Postives = 28/30 (93.33%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|