CU146534 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTGCATTACTCTTTGGTGCTTTTTACTTTGCTTTCAAAGTATGCAACTCACTGTACATGGGTCACCTCAGAAGCTTATTCATCTCCATCAATTGTCTTGGCTGCACGCGGTGCTCATGGGAACAGGGTTATCTTTGATGACTACCGTGAGGCATACTTTTGGCTCAGACAAAATACTCCTCAAGATGCTAAGATAATGTCGTGGTGGATTATGGTTACCAGAT
BLAST of CU146534 vs. Swiss-Prot
Match: STT3B_ARATH (Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B OS=Arabidopsis thaliana GN=STT3B PE=2 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 1.5e-27 Identity = 54/63 (85.71%), Postives = 57/63 (90.48%), Query Frame = 1
BLAST of CU146534 vs. Swiss-Prot
Match: STT3B_ORYSJ (Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B OS=Oryza sativa subsp. japonica GN=STT3B PE=2 SV=2) HSP 1 Score: 120.6 bits (301), Expect = 7.5e-27 Identity = 54/62 (87.10%), Postives = 55/62 (88.71%), Query Frame = 1
BLAST of CU146534 vs. Swiss-Prot
Match: STT3A_BOVIN (Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3A OS=Bos taurus GN=STT3A PE=2 SV=1) HSP 1 Score: 105.9 bits (263), Expect = 1.9e-22 Identity = 46/65 (70.77%), Postives = 52/65 (80.00%), Query Frame = 1
BLAST of CU146534 vs. Swiss-Prot
Match: STT3A_HUMAN (Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3A OS=Homo sapiens GN=STT3A PE=1 SV=2) HSP 1 Score: 105.9 bits (263), Expect = 1.9e-22 Identity = 46/65 (70.77%), Postives = 52/65 (80.00%), Query Frame = 1
BLAST of CU146534 vs. Swiss-Prot
Match: STT3A_MOUSE (Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3A OS=Mus musculus GN=Stt3a PE=1 SV=1) HSP 1 Score: 105.9 bits (263), Expect = 1.9e-22 Identity = 46/65 (70.77%), Postives = 52/65 (80.00%), Query Frame = 1
BLAST of CU146534 vs. TrEMBL
Match: A0A0A0LT73_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043120 PE=4 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 7.3e-29 Identity = 61/62 (98.39%), Postives = 61/62 (98.39%), Query Frame = 1
BLAST of CU146534 vs. TrEMBL
Match: A0A0D2UWD6_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_011G219600 PE=4 SV=1) HSP 1 Score: 132.5 bits (332), Expect = 2.1e-28 Identity = 59/62 (95.16%), Postives = 61/62 (98.39%), Query Frame = 1
BLAST of CU146534 vs. TrEMBL
Match: A0A0D2VQ62_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_011G219600 PE=4 SV=1) HSP 1 Score: 132.5 bits (332), Expect = 2.1e-28 Identity = 59/62 (95.16%), Postives = 61/62 (98.39%), Query Frame = 1
BLAST of CU146534 vs. TrEMBL
Match: A0A0D2RR20_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_011G219600 PE=4 SV=1) HSP 1 Score: 132.5 bits (332), Expect = 2.1e-28 Identity = 59/62 (95.16%), Postives = 61/62 (98.39%), Query Frame = 1
BLAST of CU146534 vs. TrEMBL
Match: A0A0D2UWM4_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_011G219600 PE=4 SV=1) HSP 1 Score: 132.5 bits (332), Expect = 2.1e-28 Identity = 59/62 (95.16%), Postives = 61/62 (98.39%), Query Frame = 1
BLAST of CU146534 vs. NCBI nr
Match: gi|449439509|ref|XP_004137528.1| (PREDICTED: dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B [Cucumis sativus]) HSP 1 Score: 134.0 bits (336), Expect = 1.0e-28 Identity = 61/62 (98.39%), Postives = 61/62 (98.39%), Query Frame = 1
BLAST of CU146534 vs. NCBI nr
Match: gi|659066959|ref|XP_008467302.1| (PREDICTED: dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B [Cucumis melo]) HSP 1 Score: 134.0 bits (336), Expect = 1.0e-28 Identity = 61/62 (98.39%), Postives = 61/62 (98.39%), Query Frame = 1
BLAST of CU146534 vs. NCBI nr
Match: gi|763806227|gb|KJB73165.1| (hypothetical protein B456_011G219600 [Gossypium raimondii]) HSP 1 Score: 132.5 bits (332), Expect = 3.0e-28 Identity = 59/62 (95.16%), Postives = 61/62 (98.39%), Query Frame = 1
BLAST of CU146534 vs. NCBI nr
Match: gi|728839000|gb|KHG18443.1| (Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3 [Gossypium arboreum]) HSP 1 Score: 132.5 bits (332), Expect = 3.0e-28 Identity = 59/62 (95.16%), Postives = 61/62 (98.39%), Query Frame = 1
BLAST of CU146534 vs. NCBI nr
Match: gi|763806226|gb|KJB73164.1| (hypothetical protein B456_011G219600 [Gossypium raimondii]) HSP 1 Score: 132.5 bits (332), Expect = 3.0e-28 Identity = 59/62 (95.16%), Postives = 61/62 (98.39%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|