CU146366 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAAAAGGATGCAGTGGACAATAAAAGGGCTGAGACCTGAGGCGTTTGAAAGCATCAAGAAAGCAAAAGGCGTTGGTTGAGAGCAAAATGCCCTGGCGTTGTGTCTTGTGCTGACATCCTAGCAATCGCAGCCAGAGATTTTGTCCATTTGGCAGGAGGGCCGTATTACCCGGTGAAGAAGGGACGATGGGACGGGAAGATCTCCATGGCGTC
BLAST of CU146366 vs. Swiss-Prot
Match: PER19_ARATH (Peroxidase 19 OS=Arabidopsis thaliana GN=PER19 PE=2 SV=1) HSP 1 Score: 80.5 bits (197), Expect = 8.1e-15 Identity = 40/70 (57.14%), Postives = 48/70 (68.57%), Query Frame = 2
BLAST of CU146366 vs. Swiss-Prot
Match: PER70_ARATH (Peroxidase 70 OS=Arabidopsis thaliana GN=PER70 PE=2 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 4.9e-12 Identity = 33/51 (64.71%), Postives = 37/51 (72.55%), Query Frame = 2
BLAST of CU146366 vs. Swiss-Prot
Match: PER47_ARATH (Peroxidase 47 OS=Arabidopsis thaliana GN=PER47 PE=2 SV=2) HSP 1 Score: 64.7 bits (156), Expect = 4.6e-10 Identity = 29/40 (72.50%), Postives = 32/40 (80.00%), Query Frame = 2
BLAST of CU146366 vs. Swiss-Prot
Match: PER55_ARATH (Peroxidase 55 OS=Arabidopsis thaliana GN=PER55 PE=1 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 6.0e-10 Identity = 37/70 (52.86%), Postives = 44/70 (62.86%), Query Frame = 2
BLAST of CU146366 vs. Swiss-Prot
Match: PER64_ARATH (Peroxidase 64 OS=Arabidopsis thaliana GN=PER64 PE=1 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.0e-09 Identity = 29/51 (56.86%), Postives = 38/51 (74.51%), Query Frame = 2
BLAST of CU146366 vs. TrEMBL
Match: A0A0A0LXH6_CUCSA (Peroxidase OS=Cucumis sativus GN=Csa_1G077120 PE=3 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 8.4e-19 Identity = 51/70 (72.86%), Postives = 56/70 (80.00%), Query Frame = 2
BLAST of CU146366 vs. TrEMBL
Match: A0A0D2S2G1_GOSRA (Peroxidase OS=Gossypium raimondii GN=B456_009G165100 PE=3 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.2e-17 Identity = 48/70 (68.57%), Postives = 54/70 (77.14%), Query Frame = 2
BLAST of CU146366 vs. TrEMBL
Match: A0A061GFA2_THECC (Peroxidase (Fragment) OS=Theobroma cacao GN=TCM_029767 PE=3 SV=1) HSP 1 Score: 95.9 bits (237), Expect = 2.1e-17 Identity = 50/70 (71.43%), Postives = 53/70 (75.71%), Query Frame = 2
BLAST of CU146366 vs. TrEMBL
Match: A0A061GEV3_THECC (Peroxidase OS=Theobroma cacao GN=TCM_029767 PE=3 SV=1) HSP 1 Score: 95.9 bits (237), Expect = 2.1e-17 Identity = 50/70 (71.43%), Postives = 53/70 (75.71%), Query Frame = 2
BLAST of CU146366 vs. TrEMBL
Match: O82477_MANES (Peroxidase (Fragment) OS=Manihot esculenta PE=3 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 2.7e-17 Identity = 49/70 (70.00%), Postives = 54/70 (77.14%), Query Frame = 2
BLAST of CU146366 vs. NCBI nr
Match: gi|449462103|ref|XP_004148781.1| (PREDICTED: peroxidase 19 [Cucumis sativus]) HSP 1 Score: 102.8 bits (255), Expect = 2.4e-19 Identity = 51/70 (72.86%), Postives = 56/70 (80.00%), Query Frame = 2
BLAST of CU146366 vs. NCBI nr
Match: gi|700209615|gb|KGN64711.1| (hypothetical protein Csa_1G077120 [Cucumis sativus]) HSP 1 Score: 102.8 bits (255), Expect = 2.4e-19 Identity = 51/70 (72.86%), Postives = 56/70 (80.00%), Query Frame = 2
BLAST of CU146366 vs. NCBI nr
Match: gi|659068140|ref|XP_008442954.1| (PREDICTED: peroxidase 19 [Cucumis melo]) HSP 1 Score: 102.8 bits (255), Expect = 2.4e-19 Identity = 51/70 (72.86%), Postives = 56/70 (80.00%), Query Frame = 2
BLAST of CU146366 vs. NCBI nr
Match: gi|823230801|ref|XP_012448119.1| (PREDICTED: peroxidase 19 [Gossypium raimondii]) HSP 1 Score: 99.0 bits (245), Expect = 3.5e-18 Identity = 48/70 (68.57%), Postives = 54/70 (77.14%), Query Frame = 2
BLAST of CU146366 vs. NCBI nr
Match: gi|590623993|ref|XP_007025479.1| (Peroxidase 19, putative isoform 1 [Theobroma cacao]) HSP 1 Score: 98.2 bits (243), Expect = 6.0e-18 Identity = 50/70 (71.43%), Postives = 53/70 (75.71%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|