CU146143 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACACTTGCAGTTATAACTATGCTGCCTTGACCTGCTGGAATCAGTGCTTTTGCTGCATGTTTTGTGCCTAAAAAGGCTCCAACTAGGTTGACATTGAGTACGTTTTGGAAGTCTGAATATTCGTTTTCGAGTATGTTGAACTTGAGAGCTCCTGGAATGCCTGCGTTGTTGAACATGATGTCTAGCTTTCCGTATTTGGAAACGGCGGTGTTAACGACTATTTTCGACGTCGGTTTTCTTTCGTTACGTTGCAGTGGACGAAGGA
BLAST of CU146143 vs. Swiss-Prot
Match: MOMAS_ORYSJ (Momilactone A synthase OS=Oryza sativa subsp. japonica GN=Os04g0179200 PE=2 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 1.2e-15 Identity = 41/71 (57.75%), Postives = 52/71 (73.24%), Query Frame = -3
BLAST of CU146143 vs. Swiss-Prot
Match: SILD_PODPE (Secoisolariciresinol dehydrogenase (Fragment) OS=Podophyllum peltatum PE=1 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.7e-14 Identity = 37/72 (51.39%), Postives = 52/72 (72.22%), Query Frame = -3
BLAST of CU146143 vs. Swiss-Prot
Match: SILD_FORIN (Secoisolariciresinol dehydrogenase (Fragment) OS=Forsythia intermedia PE=1 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 2.9e-14 Identity = 39/74 (52.70%), Postives = 50/74 (67.57%), Query Frame = -3
BLAST of CU146143 vs. Swiss-Prot
Match: TPRL2_ERYCB (Tropinone reductase-like 2 OS=Erythroxylum coca PE=2 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 9.4e-13 Identity = 37/74 (50.00%), Postives = 51/74 (68.92%), Query Frame = -3
BLAST of CU146143 vs. Swiss-Prot
Match: TPRL1_ERYCB (Tropinone reductase-like 1 OS=Erythroxylum coca PE=2 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 9.4e-13 Identity = 37/74 (50.00%), Postives = 51/74 (68.92%), Query Frame = -3
BLAST of CU146143 vs. TrEMBL
Match: A0A0A0LT69_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G168890 PE=4 SV=1) HSP 1 Score: 142.1 bits (357), Expect = 3.1e-31 Identity = 71/72 (98.61%), Postives = 72/72 (100.00%), Query Frame = -3
BLAST of CU146143 vs. TrEMBL
Match: F6HHC6_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_06s0080g01020 PE=4 SV=1) HSP 1 Score: 105.1 bits (261), Expect = 4.3e-20 Identity = 49/71 (69.01%), Postives = 61/71 (85.92%), Query Frame = -3
BLAST of CU146143 vs. TrEMBL
Match: M1CPL5_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400028021 PE=4 SV=1) HSP 1 Score: 103.2 bits (256), Expect = 1.6e-19 Identity = 49/74 (66.22%), Postives = 61/74 (82.43%), Query Frame = -3
BLAST of CU146143 vs. TrEMBL
Match: V7AGR2_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_011G096800g PE=4 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 2.8e-19 Identity = 51/71 (71.83%), Postives = 60/71 (84.51%), Query Frame = -3
BLAST of CU146143 vs. TrEMBL
Match: A0A067JQC3_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_22863 PE=4 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 2.8e-19 Identity = 49/71 (69.01%), Postives = 63/71 (88.73%), Query Frame = -3
BLAST of CU146143 vs. NCBI nr
Match: gi|449443650|ref|XP_004139590.1| (PREDICTED: secoisolariciresinol dehydrogenase [Cucumis sativus]) HSP 1 Score: 142.1 bits (357), Expect = 4.5e-31 Identity = 71/72 (98.61%), Postives = 72/72 (100.00%), Query Frame = -3
BLAST of CU146143 vs. NCBI nr
Match: gi|1009113235|ref|XP_015872388.1| (PREDICTED: secoisolariciresinol dehydrogenase-like [Ziziphus jujuba]) HSP 1 Score: 108.2 bits (269), Expect = 7.2e-21 Identity = 52/71 (73.24%), Postives = 63/71 (88.73%), Query Frame = -3
BLAST of CU146143 vs. NCBI nr
Match: gi|296084866|emb|CBI28275.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 105.1 bits (261), Expect = 6.1e-20 Identity = 49/71 (69.01%), Postives = 61/71 (85.92%), Query Frame = -3
BLAST of CU146143 vs. NCBI nr
Match: gi|225464860|ref|XP_002272206.1| (PREDICTED: secoisolariciresinol dehydrogenase-like [Vitis vinifera]) HSP 1 Score: 105.1 bits (261), Expect = 6.1e-20 Identity = 49/71 (69.01%), Postives = 61/71 (85.92%), Query Frame = -3
BLAST of CU146143 vs. NCBI nr
Match: gi|743824400|ref|XP_011022234.1| (PREDICTED: secoisolariciresinol dehydrogenase-like [Populus euphratica]) HSP 1 Score: 104.8 bits (260), Expect = 8.0e-20 Identity = 51/71 (71.83%), Postives = 61/71 (85.92%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|