CU146045 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AATGATGAATATCTCTAGAGCTCATGGGTTGATGGAGCTTGGTGATCGTTGTTTTGAGCTTGTTGAGCATCTTGATTCTTCTCGCTTAAATGAGCAGTCAAAAGCTGGCCTTCTACCTGTAAAAGCTTCTGACCTTGAAAAAGAGAGAGAGAAAGAAAAAATTAGCTAATACGAAAATCTTTTAGAAGTGAGGAGCCGAGTACATGAAT
BLAST of CU146045 vs. Swiss-Prot
Match: PP170_ARATH (Pentatricopeptide repeat-containing protein At2g25580 OS=Arabidopsis thaliana GN=PCMP-H75 PE=2 SV=2) HSP 1 Score: 70.5 bits (171), Expect = 8.3e-12 Identity = 32/53 (60.38%), Postives = 41/53 (77.36%), Query Frame = 2
BLAST of CU146045 vs. Swiss-Prot
Match: PP346_ARATH (Pentatricopeptide repeat-containing protein At4g32450, mitochondrial OS=Arabidopsis thaliana GN=PCMP-H63 PE=2 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 8.3e-12 Identity = 32/49 (65.31%), Postives = 41/49 (83.67%), Query Frame = 2
BLAST of CU146045 vs. Swiss-Prot
Match: PPR63_ARATH (Pentatricopeptide repeat-containing protein At1g29710, mitochondrial OS=Arabidopsis thaliana GN=PCMP-H67 PE=3 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 3.8e-09 Identity = 30/57 (52.63%), Postives = 38/57 (66.67%), Query Frame = 2
BLAST of CU146045 vs. Swiss-Prot
Match: PP183_ARATH (Pentatricopeptide repeat-containing protein At2g34370, mitochondrial OS=Arabidopsis thaliana GN=PCMP-H25 PE=2 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 1.8e-06 Identity = 25/52 (48.08%), Postives = 35/52 (67.31%), Query Frame = 2
BLAST of CU146045 vs. TrEMBL
Match: A0A0A0M061_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G659600 PE=4 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 2.0e-25 Identity = 63/69 (91.30%), Postives = 66/69 (95.65%), Query Frame = 2
BLAST of CU146045 vs. TrEMBL
Match: F6H3U1_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_04s0008g05070 PE=4 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 6.4e-19 Identity = 51/69 (73.91%), Postives = 60/69 (86.96%), Query Frame = 2
BLAST of CU146045 vs. TrEMBL
Match: A5AQE7_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_020760 PE=4 SV=1) HSP 1 Score: 100.9 bits (250), Expect = 6.4e-19 Identity = 51/69 (73.91%), Postives = 60/69 (86.96%), Query Frame = 2
BLAST of CU146045 vs. TrEMBL
Match: M5XL53_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa003215mg PE=4 SV=1) HSP 1 Score: 97.4 bits (241), Expect = 7.0e-18 Identity = 49/69 (71.01%), Postives = 59/69 (85.51%), Query Frame = 2
BLAST of CU146045 vs. TrEMBL
Match: B9I9F0_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0014s11190g PE=4 SV=2) HSP 1 Score: 95.1 bits (235), Expect = 3.5e-17 Identity = 47/69 (68.12%), Postives = 58/69 (84.06%), Query Frame = 2
BLAST of CU146045 vs. NCBI nr
Match: gi|778664160|ref|XP_011660234.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g32450, mitochondrial [Cucumis sativus]) HSP 1 Score: 120.6 bits (301), Expect = 1.1e-24 Identity = 63/69 (91.30%), Postives = 66/69 (95.65%), Query Frame = 2
BLAST of CU146045 vs. NCBI nr
Match: gi|659086007|ref|XP_008443720.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g32450, mitochondrial-like [Cucumis melo]) HSP 1 Score: 117.1 bits (292), Expect = 1.2e-23 Identity = 60/69 (86.96%), Postives = 65/69 (94.20%), Query Frame = 2
BLAST of CU146045 vs. NCBI nr
Match: gi|147856667|emb|CAN80315.1| (hypothetical protein VITISV_020760 [Vitis vinifera]) HSP 1 Score: 99.0 bits (245), Expect = 3.5e-18 Identity = 51/69 (73.91%), Postives = 60/69 (86.96%), Query Frame = 2
BLAST of CU146045 vs. NCBI nr
Match: gi|225430210|ref|XP_002282464.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g32450, mitochondrial [Vitis vinifera]) HSP 1 Score: 99.0 bits (245), Expect = 3.5e-18 Identity = 51/69 (73.91%), Postives = 60/69 (86.96%), Query Frame = 2
BLAST of CU146045 vs. NCBI nr
Match: gi|645223742|ref|XP_008218777.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g32450, mitochondrial [Prunus mume]) HSP 1 Score: 95.5 bits (236), Expect = 3.8e-17 Identity = 49/69 (71.01%), Postives = 59/69 (85.51%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|