CU145608 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CATGACCAATTGTTCCTTCTCGATGAGTGGTACAACAATTTCTTCAACATCATCCAATTCCCGCTACTTGAAGAAGCTCAAGAACCTGAAATCAAGAAAGAAAATCAACCAAGAAGAAAACCAAAGATCGTCATGATCATCATTGTGATATTATTGAAAATGGGATCAGTACAAGAAATATCTCAAAA
BLAST of CU145608 vs. TrEMBL
Match: A0A0A0K4L5_CUCSA (Genomic DNA, chromosome 3, P1 clone: MJL12 OS=Cucumis sativus GN=Csa_7G352430 PE=4 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 1.2e-11 Identity = 37/41 (90.24%), Postives = 37/41 (90.24%), Query Frame = 1
BLAST of CU145608 vs. TrEMBL
Match: A0A0A0K4L5_CUCSA (Genomic DNA, chromosome 3, P1 clone: MJL12 OS=Cucumis sativus GN=Csa_7G352430 PE=4 SV=1) HSP 1 Score: 37.4 bits (85), Expect = 7.8e+00 Identity = 16/16 (100.00%), Postives = 16/16 (100.00%), Query Frame = 3
BLAST of CU145608 vs. NCBI nr
Match: gi|700189397|gb|KGN44630.1| (Genomic DNA, chromosome 3, P1 clone: MJL12 [Cucumis sativus]) HSP 1 Score: 74.7 bits (182), Expect = 6.3e-11 Identity = 37/41 (90.24%), Postives = 37/41 (90.24%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|