CU145246 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTCTGATAAGAAGAATTCTCTCCTGAGAAGGAAATCTAACCGACATGGTAGTTTTTCACATTCAGTAGAAAATAACAATCAACCACAAAATTACGATGTAGTGTCTCATCAACGTATTGCTGTTTCACAAGTTAGTTTTAGGAAAGTATTTGTTCTTCTGGCGACTTATTTGGGAGGAGGCACATTTTGTTTTTTCCTGTTCGGGATCAGATCACTGGAAAGAAACAATGGGGTTTCGATTCCATTTACTTTTGTGTTGTGACAATGACCACGTTGGGTA
BLAST of CU145246 vs. TrEMBL
Match: A0A0A0LW31_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G173170 PE=4 SV=1) HSP 1 Score: 114.0 bits (284), Expect = 9.8e-23 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 2
BLAST of CU145246 vs. TrEMBL
Match: A0A0A0LW31_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G173170 PE=4 SV=1) HSP 1 Score: 48.1 bits (113), Expect = 6.6e-03 Identity = 25/31 (80.65%), Postives = 26/31 (83.87%), Query Frame = 1
BLAST of CU145246 vs. NCBI nr
Match: gi|449443674|ref|XP_004139602.1| (PREDICTED: two-pore potassium channel 1-like [Cucumis sativus]) HSP 1 Score: 107.8 bits (268), Expect = 1.0e-20 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 2
BLAST of CU145246 vs. NCBI nr
Match: gi|659128596|ref|XP_008464279.1| (PREDICTED: LOW QUALITY PROTEIN: two-pore potassium channel 1-like [Cucumis melo]) HSP 1 Score: 90.5 bits (223), Expect = 1.7e-15 Identity = 49/56 (87.50%), Postives = 54/56 (96.43%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|