CU145174 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAAAAGCAGCTATCCGGTCTCAAACTCGTTGTCTTCGACGTTTTCAAACCTTTATACGATGCTATCATGTCTCCATCCACTCATGGGTTCGATGAAGTGAGAAAAGGGTGTTGTAGCACTGGGGCTGTGGAGACGGTATCAGTCTTGTGCAATCCAAAGTTCCATGAAACATGTTCTAAATGTAACCAAATATATGTTCTGGGACAGTATTCATCTATCAGAGGCTGCCAATCAGGTGCT
BLAST of CU145174 vs. Swiss-Prot
Match: APG2_ARATH (GDSL esterase/lipase APG OS=Arabidopsis thaliana GN=APG PE=2 SV=1) HSP 1 Score: 86.7 bits (213), Expect = 1.3e-16 Identity = 38/63 (60.32%), Postives = 42/63 (66.67%), Query Frame = 1
HSP 2 Score: 36.6 bits (83), Expect = 1.5e-01 Identity = 13/20 (65.00%), Postives = 16/20 (80.00%), Query Frame = 2
BLAST of CU145174 vs. Swiss-Prot
Match: GDL78_ARATH (GDSL esterase/lipase At5g22810 OS=Arabidopsis thaliana GN=At5g22810 PE=3 SV=3) HSP 1 Score: 70.9 bits (172), Expect = 7.3e-12 Identity = 32/63 (50.79%), Postives = 40/63 (63.49%), Query Frame = 1
HSP 2 Score: 32.3 bits (72), Expect = 2.9e+00 Identity = 11/20 (55.00%), Postives = 14/20 (70.00%), Query Frame = 2
BLAST of CU145174 vs. Swiss-Prot
Match: GDL73_ARATH (GDSL esterase/lipase At5g03820 OS=Arabidopsis thaliana GN=At5g03820 PE=3 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.5e-09 Identity = 31/57 (54.39%), Postives = 38/57 (66.67%), Query Frame = 1
HSP 2 Score: 33.5 bits (75), Expect = 1.3e+00 Identity = 13/20 (65.00%), Postives = 14/20 (70.00%), Query Frame = 2
BLAST of CU145174 vs. Swiss-Prot
Match: GDL72_ARATH (GDSL esterase/lipase At5g03810 OS=Arabidopsis thaliana GN=At5g03810 PE=3 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 7.6e-09 Identity = 29/57 (50.88%), Postives = 38/57 (66.67%), Query Frame = 1
HSP 2 Score: 33.5 bits (75), Expect = 1.3e+00 Identity = 13/20 (65.00%), Postives = 14/20 (70.00%), Query Frame = 2
BLAST of CU145174 vs. Swiss-Prot
Match: EXL3_ARATH (GDSL esterase/lipase EXL3 OS=Arabidopsis thaliana GN=EXL3 PE=2 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 3.8e-08 Identity = 25/58 (43.10%), Postives = 36/58 (62.07%), Query Frame = 1
BLAST of CU145174 vs. TrEMBL
Match: A0A0A0K9R1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G452290 PE=4 SV=1) HSP 1 Score: 126.7 bits (317), Expect = 1.3e-26 Identity = 59/63 (93.65%), Postives = 60/63 (95.24%), Query Frame = 1
BLAST of CU145174 vs. TrEMBL
Match: A0A0A0K9R1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G452290 PE=4 SV=1) HSP 1 Score: 43.1 bits (100), Expect = 1.8e-01 Identity = 18/20 (90.00%), Postives = 19/20 (95.00%), Query Frame = 2
HSP 2 Score: 95.1 bits (235), Expect = 4.0e-17 Identity = 42/63 (66.67%), Postives = 48/63 (76.19%), Query Frame = 1
BLAST of CU145174 vs. TrEMBL
Match: V7BZQ3_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_005G164800g PE=4 SV=1) HSP 1 Score: 37.0 bits (84), Expect = 1.3e+01 Identity = 14/20 (70.00%), Postives = 18/20 (90.00%), Query Frame = 2
HSP 2 Score: 94.7 bits (234), Expect = 5.3e-17 Identity = 43/63 (68.25%), Postives = 47/63 (74.60%), Query Frame = 1
BLAST of CU145174 vs. TrEMBL
Match: A0A0S3SFN8_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.07G027100 PE=4 SV=1) HSP 1 Score: 37.0 bits (84), Expect = 1.3e+01 Identity = 14/20 (70.00%), Postives = 18/20 (90.00%), Query Frame = 2
HSP 2 Score: 94.4 bits (233), Expect = 6.9e-17 Identity = 43/63 (68.25%), Postives = 47/63 (74.60%), Query Frame = 1
BLAST of CU145174 vs. TrEMBL
Match: I1M5F3_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_13G353100 PE=4 SV=2) HSP 1 Score: 37.7 bits (86), Expect = 7.6e+00 Identity = 18/45 (40.00%), Postives = 24/45 (53.33%), Query Frame = 2
HSP 2 Score: 94.4 bits (233), Expect = 6.9e-17 Identity = 43/63 (68.25%), Postives = 47/63 (74.60%), Query Frame = 1
BLAST of CU145174 vs. NCBI nr
Match: gi|449447826|ref|XP_004141668.1| (PREDICTED: GDSL esterase/lipase APG [Cucumis sativus]) HSP 1 Score: 128.3 bits (321), Expect = 6.2e-27 Identity = 59/63 (93.65%), Postives = 60/63 (95.24%), Query Frame = 1
BLAST of CU145174 vs. NCBI nr
Match: gi|659124895|ref|XP_008462401.1| (PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g05700 isoform X2 [Cucumis melo]) HSP 1 Score: 115.9 bits (289), Expect = 3.2e-23 Identity = 52/63 (82.54%), Postives = 56/63 (88.89%), Query Frame = 1
BLAST of CU145174 vs. NCBI nr
Match: gi|659124897|ref|XP_008462402.1| (PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g05700 isoform X3 [Cucumis melo]) HSP 1 Score: 115.9 bits (289), Expect = 3.2e-23 Identity = 52/63 (82.54%), Postives = 56/63 (88.89%), Query Frame = 1
BLAST of CU145174 vs. NCBI nr
Match: gi|659124899|ref|XP_008462403.1| (PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At1g05700 isoform X4 [Cucumis melo]) HSP 1 Score: 115.9 bits (289), Expect = 3.2e-23 Identity = 52/63 (82.54%), Postives = 56/63 (88.89%), Query Frame = 1
BLAST of CU145174 vs. NCBI nr
Match: gi|659124901|ref|XP_008462404.1| (PREDICTED: GDSL esterase/lipase APG isoform X5 [Cucumis melo]) HSP 1 Score: 115.9 bits (289), Expect = 3.2e-23 Identity = 52/63 (82.54%), Postives = 56/63 (88.89%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|