CU145170 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAGAAGCAGGACTGTCGACATGGGGAAGATGGCCACTATCTGTAATTACTCGCAGTACTGCATTTGGTAACTCACAATGAAGCCTCACCGCATCTTTAAAGCGAATAATTCTGTCATCTTCGCCAGCAATAACAAGTGCTCTGTGCTTGACCTGTTTAATCTGGGAAATGGCATTATAACCTCCACTTTTCATAAAACTAAC
BLAST of CU145170 vs. TrEMBL
Match: A0A0A0L0M5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G102300 PE=4 SV=1) HSP 1 Score: 134.8 bits (338), Expect = 3.9e-29 Identity = 66/67 (98.51%), Postives = 66/67 (98.51%), Query Frame = -1
BLAST of CU145170 vs. TrEMBL
Match: W9R4Q7_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_021020 PE=4 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.5e-17 Identity = 42/67 (62.69%), Postives = 55/67 (82.09%), Query Frame = -1
BLAST of CU145170 vs. TrEMBL
Match: B9H0K3_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0004s11910g PE=4 SV=2) HSP 1 Score: 95.1 bits (235), Expect = 3.4e-17 Identity = 43/65 (66.15%), Postives = 53/65 (81.54%), Query Frame = -1
BLAST of CU145170 vs. TrEMBL
Match: M5WYQ8_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa007817mg PE=4 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 4.4e-17 Identity = 44/67 (65.67%), Postives = 52/67 (77.61%), Query Frame = -1
BLAST of CU145170 vs. TrEMBL
Match: B9IK72_POPTR (Hydrolase family protein OS=Populus trichocarpa GN=POPTR_0017s12890g PE=4 SV=2) HSP 1 Score: 94.7 bits (234), Expect = 4.4e-17 Identity = 41/65 (63.08%), Postives = 54/65 (83.08%), Query Frame = -1
BLAST of CU145170 vs. NCBI nr
Match: gi|778691877|ref|XP_011653371.1| (PREDICTED: uncharacterized protein LOC101203865 isoform X2 [Cucumis sativus]) HSP 1 Score: 135.6 bits (340), Expect = 3.2e-29 Identity = 66/67 (98.51%), Postives = 66/67 (98.51%), Query Frame = -1
BLAST of CU145170 vs. NCBI nr
Match: gi|700198523|gb|KGN53681.1| (hypothetical protein Csa_4G102300 [Cucumis sativus]) HSP 1 Score: 135.6 bits (340), Expect = 3.2e-29 Identity = 66/67 (98.51%), Postives = 66/67 (98.51%), Query Frame = -1
BLAST of CU145170 vs. NCBI nr
Match: gi|778691874|ref|XP_011653370.1| (PREDICTED: uncharacterized protein LOC101203865 isoform X1 [Cucumis sativus]) HSP 1 Score: 135.6 bits (340), Expect = 3.2e-29 Identity = 66/67 (98.51%), Postives = 66/67 (98.51%), Query Frame = -1
BLAST of CU145170 vs. NCBI nr
Match: gi|659120567|ref|XP_008460251.1| (PREDICTED: uncharacterized protein LOC103499127 isoform X1 [Cucumis melo]) HSP 1 Score: 131.3 bits (329), Expect = 6.1e-28 Identity = 63/67 (94.03%), Postives = 64/67 (95.52%), Query Frame = -1
BLAST of CU145170 vs. NCBI nr
Match: gi|659120569|ref|XP_008460252.1| (PREDICTED: uncharacterized protein LOC103499127 isoform X2 [Cucumis melo]) HSP 1 Score: 131.3 bits (329), Expect = 6.1e-28 Identity = 63/67 (94.03%), Postives = 64/67 (95.52%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|