CU144813 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CATTACAAATTGTGATGCTCTATTAGTTGGCACAAGAGGAGACGTTCAACCTTTTGTTTTCCATTGGGAAGCGTTTACAGGAGCATGGCCATAGAGTTAGATTGGCAACTCATGCAAATTTTAAAGATTTTGTACTCTCTACTGGACTGGAGTTCTTTCCTTTAGGAGGAGATGCTAAAGTTCTTGCCGACTATATGGTAAAGAATAAAGGATTCCTTCCATCAGGACCCTTCGGAGATACATGCCCAACGAAATCATTTGAAG
BLAST of CU144813 vs. Swiss-Prot
Match: U80A2_ARATH (Sterol 3-beta-glucosyltransferase UGT80A2 OS=Arabidopsis thaliana GN=UGT80A2 PE=1 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 8.5e-22 Identity = 52/76 (68.42%), Postives = 58/76 (76.32%), Query Frame = 3
BLAST of CU144813 vs. Swiss-Prot
Match: U80B1_ARATH (Sterol 3-beta-glucosyltransferase UGT80B1 OS=Arabidopsis thaliana GN=UGT80B1 PE=2 SV=1) HSP 1 Score: 86.7 bits (213), Expect = 1.4e-16 Identity = 38/57 (66.67%), Postives = 45/57 (78.95%), Query Frame = 3
BLAST of CU144813 vs. Swiss-Prot
Match: ATG26_YARLI (Sterol 3-beta-glucosyltransferase OS=Yarrowia lipolytica (strain CLIB 122 / E 150) GN=ATG26 PE=3 SV=3) HSP 1 Score: 52.0 bits (123), Expect = 3.8e-06 Identity = 26/57 (45.61%), Postives = 35/57 (61.40%), Query Frame = 3
BLAST of CU144813 vs. TrEMBL
Match: A0A166D3D7_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_005506 PE=4 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 1.7e-21 Identity = 56/76 (73.68%), Postives = 62/76 (81.58%), Query Frame = 3
BLAST of CU144813 vs. TrEMBL
Match: A0A0A0LXW5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G661230 PE=4 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 2.3e-21 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = 3
BLAST of CU144813 vs. TrEMBL
Match: A0A0A0LXW5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G661230 PE=4 SV=1) HSP 1 Score: 29.6 bits (65), Expect = 2.3e+03 Identity = 12/12 (100.00%), Postives = 12/12 (100.00%), Query Frame = 1
HSP 2 Score: 109.0 bits (271), Expect = 2.9e-21 Identity = 55/76 (72.37%), Postives = 62/76 (81.58%), Query Frame = 3
BLAST of CU144813 vs. TrEMBL
Match: A0A059AXC4_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_H00810 PE=4 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 2.9e-21 Identity = 55/76 (72.37%), Postives = 62/76 (81.58%), Query Frame = 3
BLAST of CU144813 vs. TrEMBL
Match: M5WHU1_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa019814mg PE=4 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 3.8e-21 Identity = 56/76 (73.68%), Postives = 60/76 (78.95%), Query Frame = 3
BLAST of CU144813 vs. NCBI nr
Match: gi|778664181|ref|XP_011660238.1| (PREDICTED: sterol 3-beta-glucosyltransferase UGT80A2-like isoform X1 [Cucumis sativus]) HSP 1 Score: 123.6 bits (309), Expect = 1.7e-25 Identity = 63/76 (82.89%), Postives = 64/76 (84.21%), Query Frame = 3
BLAST of CU144813 vs. NCBI nr
Match: gi|778664184|ref|XP_011660239.1| (PREDICTED: sterol 3-beta-glucosyltransferase UGT80A2-like isoform X2 [Cucumis sativus]) HSP 1 Score: 123.6 bits (309), Expect = 1.7e-25 Identity = 63/76 (82.89%), Postives = 64/76 (84.21%), Query Frame = 3
BLAST of CU144813 vs. NCBI nr
Match: gi|659086031|ref|XP_008443730.1| (PREDICTED: sterol 3-beta-glucosyltransferase UGT80A2-like isoform X1 [Cucumis melo]) HSP 1 Score: 122.5 bits (306), Expect = 3.7e-25 Identity = 62/76 (81.58%), Postives = 64/76 (84.21%), Query Frame = 3
BLAST of CU144813 vs. NCBI nr
Match: gi|659086033|ref|XP_008443731.1| (PREDICTED: sterol 3-beta-glucosyltransferase UGT80A2-like isoform X2 [Cucumis melo]) HSP 1 Score: 122.5 bits (306), Expect = 3.7e-25 Identity = 62/76 (81.58%), Postives = 64/76 (84.21%), Query Frame = 3
BLAST of CU144813 vs. NCBI nr
Match: gi|470138113|ref|XP_004304803.1| (PREDICTED: sterol 3-beta-glucosyltransferase UGT80A2-like [Fragaria vesca subsp. vesca]) HSP 1 Score: 112.5 bits (280), Expect = 3.8e-22 Identity = 56/76 (73.68%), Postives = 62/76 (81.58%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|