CU144474 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGAAGGTACAGATATAGTGGCGCCATTCGATGTAACGACGCCGTTTGTGTTTGATCATGCGTACTACGGAAATTTGGAAGGGAAATTGGGATTGTTGGCTACGGATCAAGGTCTGGTTCG
BLAST of CU144474 vs. TrEMBL
Match: A0A0A0LXH6_CUCSA (Peroxidase OS=Cucumis sativus GN=Csa_1G077120 PE=3 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 8.6e-13 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 3
BLAST of CU144474 vs. TrEMBL
Match: A0A061GEV3_THECC (Peroxidase OS=Theobroma cacao GN=TCM_029767 PE=3 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 3.1e-10 Identity = 32/35 (91.43%), Postives = 34/35 (97.14%), Query Frame = 3
BLAST of CU144474 vs. TrEMBL
Match: A0A061GFA2_THECC (Peroxidase (Fragment) OS=Theobroma cacao GN=TCM_029767 PE=3 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 3.1e-10 Identity = 32/35 (91.43%), Postives = 34/35 (97.14%), Query Frame = 3
BLAST of CU144474 vs. TrEMBL
Match: B9S954_RICCO (Peroxidase OS=Ricinus communis GN=RCOM_1012870 PE=3 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 5.2e-10 Identity = 32/35 (91.43%), Postives = 33/35 (94.29%), Query Frame = 3
BLAST of CU144474 vs. TrEMBL
Match: M5X173_PRUPE (Peroxidase OS=Prunus persica GN=PRUPE_ppa017084mg PE=3 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 6.8e-10 Identity = 32/35 (91.43%), Postives = 33/35 (94.29%), Query Frame = 3
BLAST of CU144474 vs. NCBI nr
Match: gi|449462103|ref|XP_004148781.1| (PREDICTED: peroxidase 19 [Cucumis sativus]) HSP 1 Score: 81.3 bits (199), Expect = 4.2e-13 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 3
BLAST of CU144474 vs. NCBI nr
Match: gi|700209615|gb|KGN64711.1| (hypothetical protein Csa_1G077120 [Cucumis sativus]) HSP 1 Score: 81.3 bits (199), Expect = 4.2e-13 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 3
BLAST of CU144474 vs. NCBI nr
Match: gi|659068140|ref|XP_008442954.1| (PREDICTED: peroxidase 19 [Cucumis melo]) HSP 1 Score: 80.1 bits (196), Expect = 9.4e-13 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 3
BLAST of CU144474 vs. NCBI nr
Match: gi|470112431|ref|XP_004292438.1| (PREDICTED: peroxidase 19 [Fragaria vesca subsp. vesca]) HSP 1 Score: 73.6 bits (179), Expect = 8.8e-11 Identity = 33/36 (91.67%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU144474 vs. NCBI nr
Match: gi|590623997|ref|XP_007025480.1| (Peroxidase 19, putative isoform 2, partial [Theobroma cacao]) HSP 1 Score: 72.8 bits (177), Expect = 1.5e-10 Identity = 32/35 (91.43%), Postives = 34/35 (97.14%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|