CU144232 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGCTGCACTTGCTTATGATGAAGCTGCAAGGGCCATGTATGGCACTTTAGCTCGCCTCTAATTTTTCCCAATGTCTCAATTTCCAACCTTGCTAAAAGGAAAAGAATTATCAAGGAAGGATTCTCGTGATGAAATCAAAAGCCCTCACTCTCTTTT
BLAST of CU144232 vs. TrEMBL
Match: A0A0A0KB02_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G124180 PE=4 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 1.6e-11 Identity = 41/48 (85.42%), Postives = 41/48 (85.42%), Query Frame = 2
BLAST of CU144232 vs. NCBI nr
Match: gi|778712752|ref|XP_011656930.1| (PREDICTED: dehydration-responsive element-binding protein 2A-like [Cucumis sativus]) HSP 1 Score: 75.9 bits (185), Expect = 2.3e-11 Identity = 41/48 (85.42%), Postives = 41/48 (85.42%), Query Frame = 2
BLAST of CU144232 vs. NCBI nr
Match: gi|659113103|ref|XP_008456436.1| (PREDICTED: putative dehydration-responsive element-binding protein 2H [Cucumis melo]) HSP 1 Score: 63.5 bits (153), Expect = 1.2e-07 Identity = 36/46 (78.26%), Postives = 36/46 (78.26%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|