CU143098 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TATTAGTCTAGGGAAAATTGGACAACATGTTGGAGATTGGGAGCATATCACTCTCAGGATCTGCAACTTTACTGGAGAACTCTTTAGCATTTTACTTTTCACAGCACAGTGGTGGTGAATGGGTGGATGCTTACAACTTAGAATTCATAGAAGGAAACAAAGCCATAGTTTACTCCTCAAAGAGTGGACATGCTAGCTATCCTCGTCCTGGGCTCTACATTCAAGGCTCTTCCAAACTCGGGATTGGAATAAGGA
BLAST of CU143098 vs. TrEMBL
Match: A0A0A0KDB1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G088000 PE=4 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 2.3e-23 Identity = 54/56 (96.43%), Postives = 55/56 (98.21%), Query Frame = 3
BLAST of CU143098 vs. TrEMBL
Match: A0A0A0KDB1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G088000 PE=4 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 9.5e-09 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = 2
HSP 2 Score: 107.8 bits (268), Expect = 6.3e-21 Identity = 49/56 (87.50%), Postives = 52/56 (92.86%), Query Frame = 3
BLAST of CU143098 vs. TrEMBL
Match: W9QPL3_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_015871 PE=4 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 7.5e-06 Identity = 23/30 (76.67%), Postives = 28/30 (93.33%), Query Frame = 2
HSP 2 Score: 106.3 bits (264), Expect = 1.8e-20 Identity = 49/56 (87.50%), Postives = 52/56 (92.86%), Query Frame = 3
BLAST of CU143098 vs. TrEMBL
Match: K4CU82_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 1.7e-05 Identity = 23/30 (76.67%), Postives = 27/30 (90.00%), Query Frame = 2
HSP 2 Score: 105.1 bits (261), Expect = 4.1e-20 Identity = 47/56 (83.93%), Postives = 53/56 (94.64%), Query Frame = 3
BLAST of CU143098 vs. TrEMBL
Match: B9IBC4_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0014s18710g PE=4 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.0e-07 Identity = 28/30 (93.33%), Postives = 29/30 (96.67%), Query Frame = 2
HSP 2 Score: 104.8 bits (260), Expect = 5.4e-20 Identity = 48/56 (85.71%), Postives = 51/56 (91.07%), Query Frame = 3
BLAST of CU143098 vs. NCBI nr
Match: gi|449445816|ref|XP_004140668.1| (PREDICTED: uncharacterized protein LOC101209282 [Cucumis sativus]) HSP 1 Score: 115.9 bits (289), Expect = 3.3e-23 Identity = 54/56 (96.43%), Postives = 55/56 (98.21%), Query Frame = 3
BLAST of CU143098 vs. NCBI nr
Match: gi|700191168|gb|KGN46372.1| (hypothetical protein Csa_6G088000 [Cucumis sativus]) HSP 1 Score: 115.9 bits (289), Expect = 3.3e-23 Identity = 54/56 (96.43%), Postives = 55/56 (98.21%), Query Frame = 3
BLAST of CU143098 vs. NCBI nr
Match: gi|659120015|ref|XP_008459966.1| (PREDICTED: uncharacterized protein LOC103498924 [Cucumis melo]) HSP 1 Score: 114.0 bits (284), Expect = 1.3e-22 Identity = 53/56 (94.64%), Postives = 54/56 (96.43%), Query Frame = 3
BLAST of CU143098 vs. NCBI nr
Match: gi|703081868|ref|XP_010091803.1| (hypothetical protein L484_015871 [Morus notabilis]) HSP 1 Score: 107.8 bits (268), Expect = 9.1e-21 Identity = 49/56 (87.50%), Postives = 52/56 (92.86%), Query Frame = 3
BLAST of CU143098 vs. NCBI nr
Match: gi|970053518|ref|XP_015088397.1| (PREDICTED: uncharacterized protein LOC107031506 isoform X2 [Solanum pennellii]) HSP 1 Score: 106.3 bits (264), Expect = 2.6e-20 Identity = 49/56 (87.50%), Postives = 52/56 (92.86%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|