CU143091 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAAGTGAGGGAGTGAGAAATGGCTCAACTTAAAAGCATCTGATTTGTTGCTGATGTAGTTGCAGCTATTGAGATCAGGGGTGTACCGTACGTGCAATGACTTTTGGGAACCTAAATCTTGAGTTATTTTTCCAATGTGTATACAATGGCTCAGCAACACATGTCGCCGAGGAAGAACCTATACAATTACTAGAACGGATCCTGCTGTTGCCATAGAAGTGAATCCTCCAAACAATGACTTTCCAGTTTC
BLAST of CU143091 vs. TrEMBL
Match: A0A0A0LGV1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G060510 PE=4 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 2.5e-06 Identity = 27/30 (90.00%), Postives = 27/30 (90.00%), Query Frame = 2
BLAST of CU143091 vs. NCBI nr
Match: gi|700206051|gb|KGN61170.1| (hypothetical protein Csa_2G060510 [Cucumis sativus]) HSP 1 Score: 59.7 bits (143), Expect = 2.8e-06 Identity = 27/30 (90.00%), Postives = 27/30 (90.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|