CU142848 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AATATTGGATGCTACAGCAACCTCCCCATACGCTTTAGGTTTTGCCTTTGGATCAGTAGGGCGCCCTCGATCCTTCTTAGCCAGCAAAGATGGACAATACTACAGACAAAGAAATTGTCACTTCTTGGGTACAATTATAAAAAAAG
BLAST of CU142848 vs. TrEMBL
Match: A0A0A0LXI0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G077180 PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 2.9e-10 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = -3
BLAST of CU142848 vs. TrEMBL
Match: A0A067GQY5_CITSI (Uncharacterized protein (Fragment) OS=Citrus sinensis GN=CISIN_1g0036001mg PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 2.3e-07 Identity = 26/32 (81.25%), Postives = 31/32 (96.88%), Query Frame = -3
BLAST of CU142848 vs. TrEMBL
Match: A0A067H361_CITSI (Uncharacterized protein (Fragment) OS=Citrus sinensis GN=CISIN_1g0036001mg PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 2.3e-07 Identity = 26/32 (81.25%), Postives = 31/32 (96.88%), Query Frame = -3
BLAST of CU142848 vs. TrEMBL
Match: V4TNL1_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10030726mg PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 2.3e-07 Identity = 26/32 (81.25%), Postives = 31/32 (96.88%), Query Frame = -3
BLAST of CU142848 vs. TrEMBL
Match: V4TDP6_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10030726mg PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 2.3e-07 Identity = 26/32 (81.25%), Postives = 31/32 (96.88%), Query Frame = -3
BLAST of CU142848 vs. NCBI nr
Match: gi|449462125|ref|XP_004148792.1| (PREDICTED: protein SDA1 homolog [Cucumis sativus]) HSP 1 Score: 72.8 bits (177), Expect = 1.9e-10 Identity = 33/33 (100.00%), Postives = 33/33 (100.00%), Query Frame = -3
BLAST of CU142848 vs. NCBI nr
Match: gi|659120701|ref|XP_008460314.1| (PREDICTED: protein SDA1 homolog [Cucumis melo]) HSP 1 Score: 71.6 bits (174), Expect = 4.1e-10 Identity = 32/33 (96.97%), Postives = 33/33 (100.00%), Query Frame = -3
BLAST of CU142848 vs. NCBI nr
Match: gi|659130649|ref|XP_008465277.1| (PREDICTED: protein SDA1 homolog isoform X1 [Cucumis melo]) HSP 1 Score: 69.3 bits (168), Expect = 2.0e-09 Identity = 31/33 (93.94%), Postives = 32/33 (96.97%), Query Frame = -3
BLAST of CU142848 vs. NCBI nr
Match: gi|659130653|ref|XP_008465279.1| (PREDICTED: protein SDA1 homolog isoform X2 [Cucumis melo]) HSP 1 Score: 69.3 bits (168), Expect = 2.0e-09 Identity = 31/33 (93.94%), Postives = 32/33 (96.97%), Query Frame = -3
BLAST of CU142848 vs. NCBI nr
Match: gi|659130655|ref|XP_008465280.1| (PREDICTED: protein SDA1 homolog isoform X3 [Cucumis melo]) HSP 1 Score: 69.3 bits (168), Expect = 2.0e-09 Identity = 31/33 (93.94%), Postives = 32/33 (96.97%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|