CU142683 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CATTGGCAACCCTTTTGGGTATGAGAAGACACTAACAGCAGGGGTGATCAGCGGATTGGGTAGAGAAATTCCATCACCAAATGGAAGGGCCATAAGGGGAGCTATTCAGACAGATGCTGCTATTAGTGCAGGAAATTCGAGGGGGGGTCCTTTTGGTTGACTCGTACGGTCAGGTTATTGGAGTCAACACAGCTAACTTTCACTCG
BLAST of CU142683 vs. Swiss-Prot
Match: DEGP5_ARATH (Protease Do-like 5, chloroplastic OS=Arabidopsis thaliana GN=DEGP5 PE=1 SV=3) HSP 1 Score: 79.0 bits (193), Expect = 2.3e-14 Identity = 38/50 (76.00%), Postives = 43/50 (86.00%), Query Frame = 2
HSP 2 Score: 28.9 bits (63), Expect = 2.7e+01 Identity = 12/16 (75.00%), Postives = 11/16 (68.75%), Query Frame = 3
BLAST of CU142683 vs. Swiss-Prot
Match: DEGP8_ARATH (Protease Do-like 8, chloroplastic OS=Arabidopsis thaliana GN=DEGP8 PE=1 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 3.4e-10 Identity = 34/50 (68.00%), Postives = 36/50 (72.00%), Query Frame = 2
BLAST of CU142683 vs. Swiss-Prot
Match: DEGP1_ARATH (Protease Do-like 1, chloroplastic OS=Arabidopsis thaliana GN=DEGP1 PE=1 SV=2) HSP 1 Score: 61.6 bits (148), Expect = 3.8e-09 Identity = 35/51 (68.63%), Postives = 36/51 (70.59%), Query Frame = 2
BLAST of CU142683 vs. Swiss-Prot
Match: DEGPL_MARMS (Probable periplasmic serine endoprotease DegP-like OS=Marinomonas sp. (strain MWYL1) GN=Mmwyl1_1102 PE=3 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 3.9e-06 Identity = 27/50 (54.00%), Postives = 33/50 (66.00%), Query Frame = 2
BLAST of CU142683 vs. Swiss-Prot
Match: DEGPL_HAHCH (Probable periplasmic serine endoprotease DegP-like OS=Hahella chejuensis (strain KCTC 2396) GN=mucD PE=3 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 5.1e-06 Identity = 27/50 (54.00%), Postives = 33/50 (66.00%), Query Frame = 2
BLAST of CU142683 vs. TrEMBL
Match: A0A0A0LV65_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025870 PE=4 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.2e-17 Identity = 49/50 (98.00%), Postives = 49/50 (98.00%), Query Frame = 2
BLAST of CU142683 vs. TrEMBL
Match: A0A0A0LV65_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025870 PE=4 SV=1) HSP 1 Score: 31.6 bits (70), Expect = 4.7e+02 Identity = 14/16 (87.50%), Postives = 14/16 (87.50%), Query Frame = 3
HSP 2 Score: 91.7 bits (226), Expect = 3.8e-16 Identity = 45/50 (90.00%), Postives = 47/50 (94.00%), Query Frame = 2
BLAST of CU142683 vs. TrEMBL
Match: A0A0D2VI33_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_011G045700 PE=4 SV=1) HSP 1 Score: 31.2 bits (69), Expect = 6.1e+02 Identity = 13/16 (81.25%), Postives = 14/16 (87.50%), Query Frame = 3
HSP 2 Score: 91.7 bits (226), Expect = 3.8e-16 Identity = 45/50 (90.00%), Postives = 47/50 (94.00%), Query Frame = 2
BLAST of CU142683 vs. TrEMBL
Match: A0A061GE60_THECC (Protease degS, putative isoform 2 OS=Theobroma cacao GN=TCM_029456 PE=4 SV=1) HSP 1 Score: 31.2 bits (69), Expect = 6.1e+02 Identity = 13/16 (81.25%), Postives = 14/16 (87.50%), Query Frame = 3
HSP 2 Score: 91.7 bits (226), Expect = 3.8e-16 Identity = 45/50 (90.00%), Postives = 47/50 (94.00%), Query Frame = 2
BLAST of CU142683 vs. TrEMBL
Match: A0A061GEY2_THECC (Protease degS, putative isoform 1 OS=Theobroma cacao GN=TCM_029456 PE=4 SV=1) HSP 1 Score: 31.2 bits (69), Expect = 6.1e+02 Identity = 13/16 (81.25%), Postives = 14/16 (87.50%), Query Frame = 3
HSP 2 Score: 90.5 bits (223), Expect = 8.5e-16 Identity = 45/50 (90.00%), Postives = 47/50 (94.00%), Query Frame = 2
BLAST of CU142683 vs. NCBI nr
Match: gi|449439571|ref|XP_004137559.1| (PREDICTED: protease Do-like 5, chloroplastic [Cucumis sativus]) HSP 1 Score: 96.7 bits (239), Expect = 1.7e-17 Identity = 49/50 (98.00%), Postives = 49/50 (98.00%), Query Frame = 2
BLAST of CU142683 vs. NCBI nr
Match: gi|659068445|ref|XP_008444456.1| (PREDICTED: protease Do-like 5, chloroplastic [Cucumis melo]) HSP 1 Score: 96.7 bits (239), Expect = 1.7e-17 Identity = 49/50 (98.00%), Postives = 49/50 (98.00%), Query Frame = 2
BLAST of CU142683 vs. NCBI nr
Match: gi|823244928|ref|XP_012455138.1| (PREDICTED: protease Do-like 5, chloroplastic [Gossypium raimondii]) HSP 1 Score: 91.7 bits (226), Expect = 5.5e-16 Identity = 45/50 (90.00%), Postives = 47/50 (94.00%), Query Frame = 2
BLAST of CU142683 vs. NCBI nr
Match: gi|590622425|ref|XP_007025046.1| (Protease degS, putative isoform 2 [Theobroma cacao]) HSP 1 Score: 91.7 bits (226), Expect = 5.5e-16 Identity = 45/50 (90.00%), Postives = 47/50 (94.00%), Query Frame = 2
BLAST of CU142683 vs. NCBI nr
Match: gi|590622421|ref|XP_007025045.1| (Protease degS, putative isoform 1 [Theobroma cacao]) HSP 1 Score: 91.7 bits (226), Expect = 5.5e-16 Identity = 45/50 (90.00%), Postives = 47/50 (94.00%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|