CU142520 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGGTTCGGGGACTTTCTTGATGGAGTTAATTGAACTTATTGCTTGCAAGAACTGCATGGGTGCGGTGGTTTTCACTGTTCAAAAAGCTAACTCTAAAGCTTTGAATTTCTACCAAAGCAAGCTGCGTTATACCATTTCATCTATTTCACCCTCACGCGTCAATTTATCGATGGCAGTCGAAACGAGCTATGAAATTCTTGCAAGGCATTTTAATGAAGACGCTAAAG
BLAST of CU142520 vs. TrEMBL
Match: A0A0A0LT37_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G030630 PE=4 SV=1) HSP 1 Score: 139.8 bits (351), Expect = 1.3e-30 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 3
BLAST of CU142520 vs. TrEMBL
Match: F6I1V6_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_17s0000g00600 PE=4 SV=1) HSP 1 Score: 104.4 bits (259), Expect = 6.3e-20 Identity = 52/75 (69.33%), Postives = 62/75 (82.67%), Query Frame = 3
BLAST of CU142520 vs. TrEMBL
Match: B9I4U9_POPTR (GCN5-related N-acetyltransferase family protein OS=Populus trichocarpa GN=POPTR_0012s03830g PE=4 SV=2) HSP 1 Score: 104.0 bits (258), Expect = 8.2e-20 Identity = 53/75 (70.67%), Postives = 63/75 (84.00%), Query Frame = 3
BLAST of CU142520 vs. TrEMBL
Match: M5WN18_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa010100mg PE=4 SV=1) HSP 1 Score: 99.0 bits (245), Expect = 2.6e-18 Identity = 51/75 (68.00%), Postives = 59/75 (78.67%), Query Frame = 3
BLAST of CU142520 vs. TrEMBL
Match: A0A103YEX2_CYNCS (Acyl-CoA N-acyltransferase OS=Cynara cardunculus var. scolymus GN=Ccrd_013796 PE=4 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.3e-17 Identity = 49/78 (62.82%), Postives = 60/78 (76.92%), Query Frame = 3
BLAST of CU142520 vs. NCBI nr
Match: gi|449439209|ref|XP_004137379.1| (PREDICTED: N-alpha-acetyltransferase 40 [Cucumis sativus]) HSP 1 Score: 138.3 bits (347), Expect = 5.6e-30 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 3
BLAST of CU142520 vs. NCBI nr
Match: gi|659066239|ref|XP_008447777.1| (PREDICTED: N-alpha-acetyltransferase 40 [Cucumis melo]) HSP 1 Score: 138.3 bits (347), Expect = 5.6e-30 Identity = 71/75 (94.67%), Postives = 72/75 (96.00%), Query Frame = 3
BLAST of CU142520 vs. NCBI nr
Match: gi|359495108|ref|XP_002263749.2| (PREDICTED: N-alpha-acetyltransferase 40 isoform X2 [Vitis vinifera]) HSP 1 Score: 102.8 bits (255), Expect = 2.6e-19 Identity = 52/75 (69.33%), Postives = 62/75 (82.67%), Query Frame = 3
BLAST of CU142520 vs. NCBI nr
Match: gi|731436124|ref|XP_010645767.1| (PREDICTED: N-alpha-acetyltransferase 40 isoform X1 [Vitis vinifera]) HSP 1 Score: 102.8 bits (255), Expect = 2.6e-19 Identity = 52/75 (69.33%), Postives = 62/75 (82.67%), Query Frame = 3
BLAST of CU142520 vs. NCBI nr
Match: gi|743913618|ref|XP_011000722.1| (PREDICTED: N-alpha-acetyltransferase 40 isoform X2 [Populus euphratica]) HSP 1 Score: 102.4 bits (254), Expect = 3.4e-19 Identity = 53/75 (70.67%), Postives = 63/75 (84.00%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|