CU142480 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTGAGTGGATTTGGTGGATGGACAGTTGTATTGTCTTTTATTTTACTTGATATGGTACTTGAGATTCCTTTGGAAAATATGATAACTATAACTTGGTCGTTCATGGTTACCCTGATTTGATGTTCAACCAAAAGTCCTGGATTGCACTCAATACAGGAAGCTTTTTGTTTAGGAATTGTCAGTGGTCTTTGGATTTGCTGGATGCTTGGGCTCCAATGGGACCAAGGGTCCTATTCGAGAAGAGGCTGGCAAGATTTTGACTGCTAAACG
BLAST of CU142480 vs. Swiss-Prot
Match: XXT3_ARATH (Probable xyloglucan 6-xylosyltransferase 3 OS=Arabidopsis thaliana GN=XXT3 PE=2 SV=1) HSP 1 Score: 121.3 bits (303), Expect = 5.3e-27 Identity = 53/75 (70.67%), Postives = 60/75 (80.00%), Query Frame = 3
HSP 2 Score: 33.1 bits (74), Expect = 1.9e+00 Identity = 15/16 (93.75%), Postives = 13/16 (81.25%), Query Frame = 2
BLAST of CU142480 vs. Swiss-Prot
Match: XXT4_ARATH (Xyloglucan 6-xylosyltransferase 4 OS=Arabidopsis thaliana GN=XXT4 PE=1 SV=1) HSP 1 Score: 117.5 bits (293), Expect = 7.6e-26 Identity = 51/75 (68.00%), Postives = 58/75 (77.33%), Query Frame = 3
BLAST of CU142480 vs. Swiss-Prot
Match: XXT5_ARATH (Probable xyloglucan 6-xylosyltransferase 5 OS=Arabidopsis thaliana GN=XXT5 PE=1 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 2.2e-25 Identity = 51/75 (68.00%), Postives = 57/75 (76.00%), Query Frame = 3
HSP 2 Score: 31.6 bits (70), Expect = 5.5e+00 Identity = 13/16 (81.25%), Postives = 13/16 (81.25%), Query Frame = 2
BLAST of CU142480 vs. Swiss-Prot
Match: GT3_ORYSI (Probable glycosyltransferase 3 OS=Oryza sativa subsp. indica GN=GT3 PE=3 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 2.1e-23 Identity = 47/75 (62.67%), Postives = 56/75 (74.67%), Query Frame = 3
BLAST of CU142480 vs. Swiss-Prot
Match: GT3_ORYSJ (Probable glycosyltransferase 3 OS=Oryza sativa subsp. japonica GN=GT3 PE=2 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 2.1e-23 Identity = 47/75 (62.67%), Postives = 56/75 (74.67%), Query Frame = 3
BLAST of CU142480 vs. TrEMBL
Match: A5B3I5_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_027037 PE=4 SV=1) HSP 1 Score: 129.4 bits (324), Expect = 2.2e-27 Identity = 59/75 (78.67%), Postives = 62/75 (82.67%), Query Frame = 3
BLAST of CU142480 vs. TrEMBL
Match: A5B3I5_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_027037 PE=4 SV=1) HSP 1 Score: 32.0 bits (71), Expect = 4.7e+02 Identity = 14/16 (87.50%), Postives = 15/16 (93.75%), Query Frame = 2
HSP 2 Score: 129.4 bits (324), Expect = 2.2e-27 Identity = 59/75 (78.67%), Postives = 62/75 (82.67%), Query Frame = 3
BLAST of CU142480 vs. TrEMBL
Match: F6GT58_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_17s0000g06590 PE=4 SV=1) HSP 1 Score: 32.0 bits (71), Expect = 4.7e+02 Identity = 14/16 (87.50%), Postives = 15/16 (93.75%), Query Frame = 2
HSP 2 Score: 128.6 bits (322), Expect = 3.7e-27 Identity = 59/75 (78.67%), Postives = 62/75 (82.67%), Query Frame = 3
BLAST of CU142480 vs. TrEMBL
Match: A0A0A0LRQ8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G009930 PE=4 SV=1) HSP 1 Score: 33.1 bits (74), Expect = 2.1e+02 Identity = 15/16 (93.75%), Postives = 15/16 (93.75%), Query Frame = 2
HSP 2 Score: 128.6 bits (322), Expect = 3.7e-27 Identity = 59/75 (78.67%), Postives = 62/75 (82.67%), Query Frame = 3
BLAST of CU142480 vs. TrEMBL
Match: A0A0A0LP65_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G010930 PE=4 SV=1) HSP 1 Score: 33.1 bits (74), Expect = 2.1e+02 Identity = 15/16 (93.75%), Postives = 15/16 (93.75%), Query Frame = 2
HSP 2 Score: 126.3 bits (316), Expect = 1.8e-26 Identity = 56/75 (74.67%), Postives = 62/75 (82.67%), Query Frame = 3
BLAST of CU142480 vs. NCBI nr
Match: gi|147855862|emb|CAN80739.1| (hypothetical protein VITISV_027037 [Vitis vinifera]) HSP 1 Score: 131.7 bits (330), Expect = 6.2e-28 Identity = 59/75 (78.67%), Postives = 62/75 (82.67%), Query Frame = 3
BLAST of CU142480 vs. NCBI nr
Match: gi|297733940|emb|CBI15187.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 131.7 bits (330), Expect = 6.2e-28 Identity = 59/75 (78.67%), Postives = 62/75 (82.67%), Query Frame = 3
BLAST of CU142480 vs. NCBI nr
Match: gi|225457345|ref|XP_002284667.1| (PREDICTED: putative glycosyltransferase 5 [Vitis vinifera]) HSP 1 Score: 131.7 bits (330), Expect = 6.2e-28 Identity = 59/75 (78.67%), Postives = 62/75 (82.67%), Query Frame = 3
BLAST of CU142480 vs. NCBI nr
Match: gi|449440812|ref|XP_004138178.1| (PREDICTED: putative glycosyltransferase 5 [Cucumis sativus]) HSP 1 Score: 131.0 bits (328), Expect = 1.1e-27 Identity = 59/75 (78.67%), Postives = 62/75 (82.67%), Query Frame = 3
BLAST of CU142480 vs. NCBI nr
Match: gi|449440814|ref|XP_004138179.1| (PREDICTED: putative glycosyltransferase 5 [Cucumis sativus]) HSP 1 Score: 131.0 bits (328), Expect = 1.1e-27 Identity = 59/75 (78.67%), Postives = 62/75 (82.67%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|