CU142229 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGGCCACCACATTTTGAGTACAAATCAATCAAACCACTGCCCACATGACTATTCTGATGGTAACCAGACTTTATCAATTTGGCGTGAAACTGGAGCCCGCCTAATAAGTCCTGTACATTTGTAAACGCTGTCAAAACGCTTGCTAAAGTAA
BLAST of CU142229 vs. Swiss-Prot
Match: PP274_ARATH (Pentatricopeptide repeat-containing protein At3g49710 OS=Arabidopsis thaliana GN=PCMP-H79 PE=2 SV=1) HSP 1 Score: 81.6 bits (200), Expect = 2.5e-15 Identity = 37/49 (75.51%), Postives = 40/49 (81.63%), Query Frame = -3
BLAST of CU142229 vs. TrEMBL
Match: A0A0A0L2J0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G508540 PE=4 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 1.6e-19 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -3
BLAST of CU142229 vs. TrEMBL
Match: A0A061DH62_THECC (Pentatricopeptide repeat (PPR) superfamily protein OS=Theobroma cacao GN=TCM_000856 PE=4 SV=1) HSP 1 Score: 92.0 bits (227), Expect = 2.1e-16 Identity = 42/49 (85.71%), Postives = 48/49 (97.96%), Query Frame = -3
BLAST of CU142229 vs. TrEMBL
Match: M5WRA0_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa022107mg PE=4 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 6.1e-16 Identity = 43/47 (91.49%), Postives = 46/47 (97.87%), Query Frame = -3
BLAST of CU142229 vs. TrEMBL
Match: V4SKL2_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10025015mg PE=4 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 1.8e-15 Identity = 39/49 (79.59%), Postives = 47/49 (95.92%), Query Frame = -3
BLAST of CU142229 vs. TrEMBL
Match: A0A067GGT4_CITSI (Uncharacterized protein (Fragment) OS=Citrus sinensis GN=CISIN_1g037537mg PE=4 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 1.8e-15 Identity = 39/49 (79.59%), Postives = 47/49 (95.92%), Query Frame = -3
BLAST of CU142229 vs. NCBI nr
Match: gi|449457327|ref|XP_004146400.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g49710 [Cucumis sativus]) HSP 1 Score: 102.1 bits (253), Expect = 2.9e-19 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -3
BLAST of CU142229 vs. NCBI nr
Match: gi|659082889|ref|XP_008442084.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g49710 [Cucumis melo]) HSP 1 Score: 100.1 bits (248), Expect = 1.1e-18 Identity = 48/49 (97.96%), Postives = 48/49 (97.96%), Query Frame = -3
BLAST of CU142229 vs. NCBI nr
Match: gi|694369060|ref|XP_009362618.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g49710 [Pyrus x bretschneideri]) HSP 1 Score: 92.4 bits (228), Expect = 2.3e-16 Identity = 44/49 (89.80%), Postives = 47/49 (95.92%), Query Frame = -3
BLAST of CU142229 vs. NCBI nr
Match: gi|1009155694|ref|XP_015895848.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g49710-like [Ziziphus jujuba]) HSP 1 Score: 92.4 bits (228), Expect = 2.3e-16 Identity = 44/49 (89.80%), Postives = 47/49 (95.92%), Query Frame = -3
BLAST of CU142229 vs. NCBI nr
Match: gi|470103730|ref|XP_004288283.1| (PREDICTED: pentatricopeptide repeat-containing protein At3g49710 [Fragaria vesca subsp. vesca]) HSP 1 Score: 92.4 bits (228), Expect = 2.3e-16 Identity = 44/49 (89.80%), Postives = 47/49 (95.92%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|