CU142129 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGAAGAACCTCAGAAAGTGGAGGTTCTTTCTGAGCAATCAAAGAATTCTCCCACAGAAAATGGGTTCGGAGAAGACTTAGTGCATACTGATGGGGGAAGCCAGGAAGCTTCAATAAGTGATGGGGATGAAAGTTTGGAAAAAGGAAAAGGTCAGAGGAGTGTGGAGGAAGAGCAGATTTTTGATGCACCAGTTGACCTGCAGGGTACAGGGCTTGGAGTTTCAG
BLAST of CU142129 vs. TrEMBL
Match: A0A0A0KQ10_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G175900 PE=4 SV=1) HSP 1 Score: 149.1 bits (375), Expect = 2.2e-33 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = 2
BLAST of CU142129 vs. NCBI nr
Match: gi|778700771|ref|XP_011654914.1| (PREDICTED: uncharacterized protein LOC101204371 [Cucumis sativus]) HSP 1 Score: 142.1 bits (357), Expect = 3.8e-31 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = 2
BLAST of CU142129 vs. NCBI nr
Match: gi|700195290|gb|KGN50467.1| (hypothetical protein Csa_5G175900 [Cucumis sativus]) HSP 1 Score: 142.1 bits (357), Expect = 3.8e-31 Identity = 74/74 (100.00%), Postives = 74/74 (100.00%), Query Frame = 2
BLAST of CU142129 vs. NCBI nr
Match: gi|659090132|ref|XP_008445854.1| (PREDICTED: uncharacterized protein LOC103488747 isoform X1 [Cucumis melo]) HSP 1 Score: 129.0 bits (323), Expect = 3.4e-27 Identity = 68/74 (91.89%), Postives = 69/74 (93.24%), Query Frame = 2
BLAST of CU142129 vs. NCBI nr
Match: gi|659090134|ref|XP_008445855.1| (PREDICTED: uncharacterized protein LOC103488747 isoform X2 [Cucumis melo]) HSP 1 Score: 129.0 bits (323), Expect = 3.4e-27 Identity = 68/74 (91.89%), Postives = 69/74 (93.24%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|