CU142058 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CATTTCTATCTTCTCTTGCCTCCTGAAAATCTGCCACGTTCCAAGGCCAAACGTGAGAGCACCAGGTAGAAACAGTAGCCATTTCGACAATCTCGACTCTCTTTGTTTCTGTTGAGGTTGCGAAAGGGAAGATGAGTTGGGATCAGGAGTAGAACGAAACTACCGCGGCAGAACTGAAGGAAGAAGAAGATGAAGGTAAAGGCGTCGAAGAATGGCCAGAAAAGGGAAAAACAAGGGCGAAAATTTTTGTGATGGATTTAGCTAAGGAAGAA
BLAST of CU142058 vs. Swiss-Prot
Match: SURF1_ARATH (Surfeit locus protein 1 OS=Arabidopsis thaliana GN=SURF1 PE=2 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 2.5e-08 Identity = 27/44 (61.36%), Postives = 34/44 (77.27%), Query Frame = -3
BLAST of CU142058 vs. TrEMBL
Match: A0A0A0LVW3_CUCSA (SURF1-like protein OS=Cucumis sativus GN=Csa_1G042880 PE=3 SV=1) HSP 1 Score: 107.1 bits (266), Expect = 1.2e-20 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = -3
BLAST of CU142058 vs. TrEMBL
Match: B9I2C9_POPTR (SURF1-like protein OS=Populus trichocarpa GN=POPTR_0012s04250g PE=3 SV=2) HSP 1 Score: 70.5 bits (171), Expect = 1.2e-09 Identity = 30/41 (73.17%), Postives = 37/41 (90.24%), Query Frame = -3
BLAST of CU142058 vs. TrEMBL
Match: M5WUQ5_PRUPE (SURF1-like protein OS=Prunus persica GN=PRUPE_ppa007867mg PE=3 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 1.2e-09 Identity = 34/51 (66.67%), Postives = 42/51 (82.35%), Query Frame = -3
BLAST of CU142058 vs. TrEMBL
Match: A0A068TSK1_COFCA (SURF1-like protein OS=Coffea canephora GN=GSCOC_T00022390001 PE=3 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 4.6e-09 Identity = 34/52 (65.38%), Postives = 42/52 (80.77%), Query Frame = -3
BLAST of CU142058 vs. TrEMBL
Match: B9SXS0_RICCO (SURF1-like protein OS=Ricinus communis GN=RCOM_0569510 PE=3 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 7.8e-09 Identity = 33/51 (64.71%), Postives = 40/51 (78.43%), Query Frame = -3
BLAST of CU142058 vs. NCBI nr
Match: gi|449439471|ref|XP_004137509.1| (PREDICTED: surfeit locus protein 1 [Cucumis sativus]) HSP 1 Score: 107.1 bits (266), Expect = 1.7e-20 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = -3
BLAST of CU142058 vs. NCBI nr
Match: gi|659066886|ref|XP_008465733.1| (PREDICTED: surfeit locus protein 1 [Cucumis melo]) HSP 1 Score: 107.1 bits (266), Expect = 1.7e-20 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = -3
BLAST of CU142058 vs. NCBI nr
Match: gi|743890860|ref|XP_011039174.1| (PREDICTED: surfeit locus protein 1 [Populus euphratica]) HSP 1 Score: 71.2 bits (173), Expect = 1.0e-09 Identity = 30/41 (73.17%), Postives = 37/41 (90.24%), Query Frame = -3
BLAST of CU142058 vs. NCBI nr
Match: gi|566196743|ref|XP_002317864.2| (hypothetical protein POPTR_0012s04250g [Populus trichocarpa]) HSP 1 Score: 71.2 bits (173), Expect = 1.0e-09 Identity = 30/41 (73.17%), Postives = 37/41 (90.24%), Query Frame = -3
BLAST of CU142058 vs. NCBI nr
Match: gi|645269731|ref|XP_008240132.1| (PREDICTED: surfeit locus protein 1 [Prunus mume]) HSP 1 Score: 70.5 bits (171), Expect = 1.7e-09 Identity = 34/51 (66.67%), Postives = 42/51 (82.35%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|