CU141928 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTACTTCGTGTGGCCGTCCATGATGACTCGAACACTAATGCGAGGCCTCTGCAACCTTTGAATAATCGAAACGTTCAACTTCGAATCAAAGCAAGCATAGAGGGAGCAGAATGATTGATTCATAGACACACACATACCAGAATTATTTCTTCATTTTTCTTTCTCAATATCGTATGGTTATTACCATACATATCTTGTTTCTTTGTTTAATTTATATATGATATACACATGTGTTATCATTTTTATAA
BLAST of CU141928 vs. TrEMBL
Match: A0A0A0LV23_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G120450 PE=4 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 3.4e-11 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of CU141928 vs. TrEMBL
Match: S6DFU0_CUCSA (Bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3 OS=Cucumis sativus PE=2 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 1.7e-10 Identity = 36/37 (97.30%), Postives = 36/37 (97.30%), Query Frame = 1
BLAST of CU141928 vs. TrEMBL
Match: A0A0A0LXW4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G120420 PE=4 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 1.7e-10 Identity = 36/37 (97.30%), Postives = 36/37 (97.30%), Query Frame = 1
BLAST of CU141928 vs. NCBI nr
Match: gi|659071960|ref|XP_008462808.1| (PREDICTED: bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3-like [Cucumis melo]) HSP 1 Score: 76.6 bits (187), Expect = 2.2e-11 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of CU141928 vs. NCBI nr
Match: gi|778659160|ref|XP_011653931.1| (PREDICTED: alpha carbonic anhydrase 7-like [Cucumis sativus]) HSP 1 Score: 76.6 bits (187), Expect = 2.2e-11 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of CU141928 vs. NCBI nr
Match: gi|659071962|ref|XP_008462817.1| (PREDICTED: bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3-like [Cucumis melo]) HSP 1 Score: 76.3 bits (186), Expect = 2.9e-11 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of CU141928 vs. NCBI nr
Match: gi|778659157|ref|XP_004139553.2| (PREDICTED: alpha carbonic anhydrase 7-like [Cucumis sativus]) HSP 1 Score: 74.3 bits (181), Expect = 1.1e-10 Identity = 36/37 (97.30%), Postives = 36/37 (97.30%), Query Frame = 1
BLAST of CU141928 vs. NCBI nr
Match: gi|520957809|emb|CDF47511.1| (bifunctional monodehydroascorbate reductase and carbonic anhydrase nectarin-3 [Cucumis sativus]) HSP 1 Score: 74.3 bits (181), Expect = 1.1e-10 Identity = 36/37 (97.30%), Postives = 36/37 (97.30%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|