CU141744 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGAAAGAAGGCAAAAAGGAAAGCCCGAGAGAAACAACTTGAAGAGGCCAGGAGGCTTGCTTCTCTGCAAAAAAGAAGAGAGCTAAAAGCTGCAGGAATTGATACTCGACAAAGGAAGAGAAAAGAGAAAAGGAATAGATTACAATGCTGAAATTCCTTTTGAGAAAAAGCCTCCTCAGGATTTTTTGACGTTAGTGAGGAAGACAGACCAGTGGAACAGCCC
BLAST of CU141744 vs. Swiss-Prot
Match: CDC5L_ARATH (Cell division cycle 5-like protein OS=Arabidopsis thaliana GN=CDC5 PE=1 SV=2) HSP 1 Score: 95.5 bits (236), Expect = 2.6e-19 Identity = 50/73 (68.49%), Postives = 55/73 (75.34%), Query Frame = 2
BLAST of CU141744 vs. Swiss-Prot
Match: CDC5L_NEMVE (Cell division cycle 5-related protein OS=Nematostella vectensis GN=cdc5l PE=3 SV=1) HSP 1 Score: 86.7 bits (213), Expect = 1.2e-16 Identity = 45/74 (60.81%), Postives = 55/74 (74.32%), Query Frame = 2
BLAST of CU141744 vs. Swiss-Prot
Match: CDC5L_BOVIN (Cell division cycle 5-like protein OS=Bos taurus GN=CDC5L PE=2 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 3.3e-14 Identity = 40/68 (58.82%), Postives = 52/68 (76.47%), Query Frame = 2
BLAST of CU141744 vs. Swiss-Prot
Match: CDC5L_MOUSE (Cell division cycle 5-like protein OS=Mus musculus GN=Cdc5l PE=1 SV=2) HSP 1 Score: 78.6 bits (192), Expect = 3.3e-14 Identity = 40/68 (58.82%), Postives = 52/68 (76.47%), Query Frame = 2
BLAST of CU141744 vs. Swiss-Prot
Match: CDC5L_RAT (Cell division cycle 5-like protein OS=Rattus norvegicus GN=Cdc5l PE=1 SV=2) HSP 1 Score: 78.6 bits (192), Expect = 3.3e-14 Identity = 40/68 (58.82%), Postives = 52/68 (76.47%), Query Frame = 2
BLAST of CU141744 vs. TrEMBL
Match: A0A0A0M0E8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G682630 PE=4 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 2.5e-21 Identity = 59/74 (79.73%), Postives = 60/74 (81.08%), Query Frame = 2
BLAST of CU141744 vs. TrEMBL
Match: A0A0A0K6R7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G431360 PE=4 SV=1) HSP 1 Score: 107.5 bits (267), Expect = 7.3e-21 Identity = 58/74 (78.38%), Postives = 59/74 (79.73%), Query Frame = 2
BLAST of CU141744 vs. TrEMBL
Match: A0A0K9RDE1_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_079390 PE=4 SV=1) HSP 1 Score: 105.9 bits (263), Expect = 2.1e-20 Identity = 56/74 (75.68%), Postives = 61/74 (82.43%), Query Frame = 2
BLAST of CU141744 vs. TrEMBL
Match: M5WK14_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa000753mg PE=4 SV=1) HSP 1 Score: 105.5 bits (262), Expect = 2.8e-20 Identity = 56/74 (75.68%), Postives = 60/74 (81.08%), Query Frame = 2
BLAST of CU141744 vs. TrEMBL
Match: A0A0J8CQ19_BETVU (Uncharacterized protein OS=Beta vulgaris subsp. vulgaris GN=BVRB_4g079310 PE=4 SV=1) HSP 1 Score: 105.5 bits (262), Expect = 2.8e-20 Identity = 56/74 (75.68%), Postives = 60/74 (81.08%), Query Frame = 2
BLAST of CU141744 vs. NCBI nr
Match: gi|778665422|ref|XP_011648556.1| (PREDICTED: LOW QUALITY PROTEIN: cell division cycle 5-like protein [Cucumis sativus]) HSP 1 Score: 97.1 bits (240), Expect = 1.4e-17 Identity = 59/74 (79.73%), Postives = 60/74 (81.08%), Query Frame = 2
BLAST of CU141744 vs. NCBI nr
Match: gi|700211673|gb|KGN66769.1| (hypothetical protein Csa_1G682630 [Cucumis sativus]) HSP 1 Score: 97.1 bits (240), Expect = 1.4e-17 Identity = 59/74 (79.73%), Postives = 60/74 (81.08%), Query Frame = 2
BLAST of CU141744 vs. NCBI nr
Match: gi|659107433|ref|XP_008453669.1| (PREDICTED: LOW QUALITY PROTEIN: cell division cycle 5-like protein [Cucumis melo]) HSP 1 Score: 97.1 bits (240), Expect = 1.4e-17 Identity = 59/74 (79.73%), Postives = 60/74 (81.08%), Query Frame = 2
BLAST of CU141744 vs. NCBI nr
Match: gi|659122536|ref|XP_008461195.1| (PREDICTED: LOW QUALITY PROTEIN: cell division cycle 5-like protein [Cucumis melo]) HSP 1 Score: 95.9 bits (237), Expect = 3.2e-17 Identity = 58/74 (78.38%), Postives = 60/74 (81.08%), Query Frame = 2
BLAST of CU141744 vs. NCBI nr
Match: gi|700189970|gb|KGN45203.1| (hypothetical protein Csa_7G431360 [Cucumis sativus]) HSP 1 Score: 95.5 bits (236), Expect = 4.1e-17 Identity = 58/74 (78.38%), Postives = 59/74 (79.73%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|