CU141672 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAATTCCCGTCCCCCAAGAATAGGGTGCAATGTTCTAGTCTCTTCTTTGCGACTCCCACTTTCCCCATGGATAACCAAAGCTTCATCTTCATGTTTTCGTTTTCCCCGACCCCTGTTTTCGTTTCCCGGACTCCTCCTCTTAGGCCTGCACTGCTCCACTTTTTCTCATCTTCTACTGCCTCCACCGATGCTTTTTCCACTCGGTGCGCTCCGGATCAGCTCCGGAAATGGCAAGCTTTCCGTAAGAAAAAGGTCGTTTTGCGAATCGGCTATGTCGGGACTGAT
BLAST of CU141672 vs. TrEMBL
Match: A0A0A0LVB6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G533670 PE=4 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 2.4e-16 Identity = 49/77 (63.64%), Postives = 51/77 (66.23%), Query Frame = 1
BLAST of CU141672 vs. NCBI nr
Match: gi|700210764|gb|KGN65860.1| (hypothetical protein Csa_1G533670 [Cucumis sativus]) HSP 1 Score: 92.0 bits (227), Expect = 5.8e-16 Identity = 49/77 (63.64%), Postives = 51/77 (66.23%), Query Frame = 1
BLAST of CU141672 vs. NCBI nr
Match: gi|449454977|ref|XP_004145230.1| (PREDICTED: putative tRNA pseudouridine synthase [Cucumis sativus]) HSP 1 Score: 92.0 bits (227), Expect = 5.8e-16 Identity = 49/77 (63.64%), Postives = 51/77 (66.23%), Query Frame = 1
BLAST of CU141672 vs. NCBI nr
Match: gi|659114949|ref|XP_008457308.1| (PREDICTED: putative tRNA pseudouridine synthase [Cucumis melo]) HSP 1 Score: 82.0 bits (201), Expect = 6.0e-13 Identity = 45/77 (58.44%), Postives = 48/77 (62.34%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|