|
|
The following sequences are available for this feature:
transcribed_cluster sequence AAACTCATGGAGATGGGATTCCCCGAGGCTCAAGTAAGGAGGCAGTTTTGGAAGCTG
The following BLAST results are available for this feature:
| Match Name | E-value | Identity | Description | |
|---|
The following terms have been associated with this transcribed_cluster:
Vocabulary: INTERPRO
| Term | Definition |
|---|
| IPR015940 | UBA |
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
| Feature Name | Unique Name | Type |
|---|
| G0083668 | G0083668 | EST |
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
| IPR Term | IPR Description | Source | Source Term | Source Description | Alignment |
|---|
| IPR015940 | Ubiquitin-associated domain | PFAM | PF00627 | UBA | coord: 2..14
score: 1. |
| None | No IPR available | GENE3D | G3DSA:1.10.8.10 | | coord: 2..14
score: 3. |
|
