CU140884 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGGTTGATTCCGGTCGGGGGTGACAGTGGCTGGATACGTCCTCCTAATTCTGACTTCTATTCCTCTTGGGCCGCGGGTCTAAAGTTTACCGTCGGAGATATTTTAGTGTTCAAACTTTATGGCGGGAGCTCACGACGTGGCCGGAGTGACAAAAGAAGGTTACGACAACTGCATCACAACCGATCCTATATTCTTAAACACTACATCCCCTTTTTCTTTCACTCTCGATAAACTTGACGATTTACTTTTTCATCTGCA
BLAST of CU140884 vs. TrEMBL
Match: A0A0A0LU53_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G348430 PE=4 SV=1) HSP 1 Score: 95.9 bits (237), Expect = 2.5e-17 Identity = 44/46 (95.65%), Postives = 44/46 (95.65%), Query Frame = 2
BLAST of CU140884 vs. TrEMBL
Match: A0A0A0LU53_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G348430 PE=4 SV=1) HSP 1 Score: 79.3 bits (194), Expect = 2.5e-12 Identity = 35/36 (97.22%), Postives = 36/36 (100.00%), Query Frame = 1
BLAST of CU140884 vs. NCBI nr
Match: gi|449464640|ref|XP_004150037.1| (PREDICTED: cucumber peeling cupredoxin-like [Cucumis sativus]) HSP 1 Score: 95.9 bits (237), Expect = 3.6e-17 Identity = 44/46 (95.65%), Postives = 44/46 (95.65%), Query Frame = 2
BLAST of CU140884 vs. NCBI nr
Match: gi|659086521|ref|XP_008443977.1| (PREDICTED: umecyanin-like [Cucumis melo]) HSP 1 Score: 81.6 bits (200), Expect = 7.1e-13 Identity = 36/46 (78.26%), Postives = 39/46 (84.78%), Query Frame = 2
BLAST of CU140884 vs. NCBI nr
Match: gi|778730563|ref|XP_011659820.1| (PREDICTED: umecyanin [Cucumis sativus]) HSP 1 Score: 67.8 bits (164), Expect = 1.1e-08 Identity = 31/46 (67.39%), Postives = 37/46 (80.43%), Query Frame = 2
BLAST of CU140884 vs. NCBI nr
Match: gi|659086649|ref|XP_008444048.1| (PREDICTED: umecyanin-like [Cucumis melo]) HSP 1 Score: 61.6 bits (148), Expect = 7.6e-07 Identity = 28/40 (70.00%), Postives = 32/40 (80.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|