CU140878 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTCATAACCCTTCTTACAAGGACTACAATACCCTTGTTAGGGTCCCGACTCACTCGTGATGCCGCTCGAATTCAATTCCTTAACCGAAATCTTGAGCGCTCTTTAAATGGGGGTACTCATTTTGGTGAAAGTATTAATGAATCTCTAATTGGAGATTCAATTACTGCTCCGGTTGTTTCGGGGCAAAGTAAAGGGAGTGGTGCTGAGTATTTAGCTCAGATTGGGGGTTGGTCAGCCTGTGAAGTTGTTTTATTTGGTGCCTGATACTGGTAGCG
BLAST of CU140878 vs. TrEMBL
Match: A0A0A0LPJ3_CUCSA (Aspartic proteinase nepenthesin-1 OS=Cucumis sativus GN=Csa_1G022490 PE=3 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 2.3e-24 Identity = 59/61 (96.72%), Postives = 61/61 (100.00%), Query Frame = 2
BLAST of CU140878 vs. TrEMBL
Match: A0A0A0LPJ3_CUCSA (Aspartic proteinase nepenthesin-1 OS=Cucumis sativus GN=Csa_1G022490 PE=3 SV=1) HSP 1 Score: 42.0 bits (97), Expect = 4.6e-01 Identity = 20/31 (64.52%), Postives = 23/31 (74.19%), Query Frame = 3
HSP 2 Score: 63.9 bits (154), Expect = 1.1e-07 Identity = 36/61 (59.02%), Postives = 42/61 (68.85%), Query Frame = 2
BLAST of CU140878 vs. TrEMBL
Match: A0A0A0LS14_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G022480 PE=3 SV=1) HSP 1 Score: 33.9 bits (76), Expect = 1.3e+02 Identity = 13/19 (68.42%), Postives = 17/19 (89.47%), Query Frame = 3
BLAST of CU140878 vs. NCBI nr
Match: gi|449440933|ref|XP_004138238.1| (PREDICTED: protein ASPARTIC PROTEASE IN GUARD CELL 1-like [Cucumis sativus]) HSP 1 Score: 119.0 bits (297), Expect = 4.3e-24 Identity = 59/61 (96.72%), Postives = 61/61 (100.00%), Query Frame = 2
BLAST of CU140878 vs. NCBI nr
Match: gi|659106559|ref|XP_008453384.1| (PREDICTED: protein ASPARTIC PROTEASE IN GUARD CELL 1-like [Cucumis melo]) HSP 1 Score: 102.1 bits (253), Expect = 5.4e-19 Identity = 51/61 (83.61%), Postives = 54/61 (88.52%), Query Frame = 2
BLAST of CU140878 vs. NCBI nr
Match: gi|659106557|ref|XP_008453383.1| (PREDICTED: protein ASPARTIC PROTEASE IN GUARD CELL 1 [Cucumis melo]) HSP 1 Score: 64.3 bits (155), Expect = 1.2e-07 Identity = 35/61 (57.38%), Postives = 41/61 (67.21%), Query Frame = 2
BLAST of CU140878 vs. NCBI nr
Match: gi|778664722|ref|XP_004138237.2| (PREDICTED: protein ASPARTIC PROTEASE IN GUARD CELL 1-like [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 1.6e-07 Identity = 36/61 (59.02%), Postives = 42/61 (68.85%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|