CU140648 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTCATTTATCGTTTCTGTTGGACCTTTCCTCCTTTCAGTAGAGTACGTATTCTGAAAGATTTTATTTTGTTGAGATATTGGTGATTGTGGTGGTGTCTCTAGTGGCCGGATTTTACCATCATCAAATAGCTCGTCGGCTGATAGTGTGGTTGCCTCTAACTGCTGGCATATATCAAATGCAAAATCTTCATCCTCCATTTCTGGTTCATCC
BLAST of CU140648 vs. TrEMBL
Match: A0A0A0L082_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G639070 PE=4 SV=1) HSP 1 Score: 146.4 bits (368), Expect = 1.3e-32 Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = -2
BLAST of CU140648 vs. TrEMBL
Match: A5BH42_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_017086 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 9.7e-07 Identity = 28/44 (63.64%), Postives = 33/44 (75.00%), Query Frame = -2
BLAST of CU140648 vs. TrEMBL
Match: F6HQE2_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_03s0063g00880 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 9.7e-07 Identity = 28/44 (63.64%), Postives = 33/44 (75.00%), Query Frame = -2
BLAST of CU140648 vs. TrEMBL
Match: B9GNY3_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0002s13000g PE=4 SV=2) HSP 1 Score: 60.5 bits (145), Expect = 9.7e-07 Identity = 30/72 (41.67%), Postives = 43/72 (59.72%), Query Frame = -2
BLAST of CU140648 vs. TrEMBL
Match: A0A0D2TT45_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_009G209200 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 9.7e-07 Identity = 31/77 (40.26%), Postives = 44/77 (57.14%), Query Frame = -2
BLAST of CU140648 vs. NCBI nr
Match: gi|449447231|ref|XP_004141372.1| (PREDICTED: uncharacterized protein LOC101222235 [Cucumis sativus]) HSP 1 Score: 141.7 bits (356), Expect = 4.7e-31 Identity = 70/70 (100.00%), Postives = 70/70 (100.00%), Query Frame = -2
BLAST of CU140648 vs. NCBI nr
Match: gi|659105309|ref|XP_008453065.1| (PREDICTED: pinin [Cucumis melo]) HSP 1 Score: 140.6 bits (353), Expect = 1.1e-30 Identity = 69/70 (98.57%), Postives = 70/70 (100.00%), Query Frame = -2
BLAST of CU140648 vs. NCBI nr
Match: gi|1009136239|ref|XP_015885427.1| (PREDICTED: uncharacterized protein LOC107420880 [Ziziphus jujuba]) HSP 1 Score: 58.2 bits (139), Expect = 6.9e-06 Identity = 31/64 (48.44%), Postives = 41/64 (64.06%), Query Frame = -2
BLAST of CU140648 vs. NCBI nr
Match: gi|225428735|ref|XP_002281981.1| (PREDICTED: uncharacterized protein LOC100253812 [Vitis vinifera]) HSP 1 Score: 58.2 bits (139), Expect = 6.9e-06 Identity = 28/44 (63.64%), Postives = 33/44 (75.00%), Query Frame = -2
BLAST of CU140648 vs. NCBI nr
Match: gi|147811058|emb|CAN63485.1| (hypothetical protein VITISV_017086 [Vitis vinifera]) HSP 1 Score: 58.2 bits (139), Expect = 6.9e-06 Identity = 28/44 (63.64%), Postives = 33/44 (75.00%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|