CU140533 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCTTGTTTTCTTTTCTGGAAACTGAGATAGAATCATATAAATTACCAATCTAAAGCAGTGATGGTAACTCCAGCCCAGAGAGGCAAAGCTCCATTACTCAGAATCTTAATAGCAATAGCACTCCCAATGACTTCCTGTATATCAGCCCCAATGAGGGCAAACTCCGCCATGACCCACGGCACAAT
BLAST of CU140533 vs. Swiss-Prot
Match: NRAM3_ARATH (Metal transporter Nramp3 OS=Arabidopsis thaliana GN=NRAMP3 PE=2 SV=2) HSP 1 Score: 79.7 bits (195), Expect = 1.2e-14 Identity = 40/46 (86.96%), Postives = 40/46 (86.96%), Query Frame = -1
BLAST of CU140533 vs. Swiss-Prot
Match: NRAM4_ARATH (Metal transporter Nramp4 OS=Arabidopsis thaliana GN=NRAMP4 PE=2 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.2e-14 Identity = 42/60 (70.00%), Postives = 45/60 (75.00%), Query Frame = -1
BLAST of CU140533 vs. Swiss-Prot
Match: NRAM6_ORYSJ (Metal transporter Nramp6 OS=Oryza sativa subsp. japonica GN=NRAMP6 PE=2 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 3.9e-13 Identity = 36/43 (83.72%), Postives = 37/43 (86.05%), Query Frame = -1
BLAST of CU140533 vs. Swiss-Prot
Match: NRAM2_ARATH (Metal transporter Nramp2 OS=Arabidopsis thaliana GN=NRAMP2 PE=2 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 1.9e-12 Identity = 40/59 (67.80%), Postives = 41/59 (69.49%), Query Frame = -1
BLAST of CU140533 vs. Swiss-Prot
Match: NRAM2_ORYSJ (Metal transporter Nramp2 OS=Oryza sativa subsp. japonica GN=NRAMP2 PE=2 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 7.3e-12 Identity = 36/57 (63.16%), Postives = 38/57 (66.67%), Query Frame = -1
BLAST of CU140533 vs. TrEMBL
Match: A0A0A0LN03_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G423700 PE=3 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 2.2e-15 Identity = 48/60 (80.00%), Postives = 50/60 (83.33%), Query Frame = -1
BLAST of CU140533 vs. TrEMBL
Match: M5VXT2_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa004490mg PE=3 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 2.1e-13 Identity = 44/60 (73.33%), Postives = 48/60 (80.00%), Query Frame = -1
BLAST of CU140533 vs. TrEMBL
Match: Q3ZN86_NOCCA (Nramp metal transporter-like protein OS=Noccaea caerulescens GN=Nramp3 PE=2 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 2.1e-13 Identity = 43/60 (71.67%), Postives = 49/60 (81.67%), Query Frame = -1
BLAST of CU140533 vs. TrEMBL
Match: A6YPU3_NOCCA (Metal transporter NRAMP3 OS=Noccaea caerulescens GN=NRAMP3 PE=2 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 2.1e-13 Identity = 43/60 (71.67%), Postives = 49/60 (81.67%), Query Frame = -1
BLAST of CU140533 vs. TrEMBL
Match: A0A165FX05_9ROSA (Metal transporter Nramp3 OS=Pyrus betulifolia GN=Nramp3 PE=2 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 2.7e-13 Identity = 44/60 (73.33%), Postives = 48/60 (80.00%), Query Frame = -1
BLAST of CU140533 vs. NCBI nr
Match: gi|449468323|ref|XP_004151871.1| (PREDICTED: metal transporter Nramp3-like [Cucumis sativus]) HSP 1 Score: 89.0 bits (219), Expect = 3.2e-15 Identity = 48/60 (80.00%), Postives = 50/60 (83.33%), Query Frame = -1
BLAST of CU140533 vs. NCBI nr
Match: gi|659111615|ref|XP_008455821.1| (PREDICTED: metal transporter Nramp3-like [Cucumis melo]) HSP 1 Score: 86.7 bits (213), Expect = 1.6e-14 Identity = 47/60 (78.33%), Postives = 49/60 (81.67%), Query Frame = -1
BLAST of CU140533 vs. NCBI nr
Match: gi|57231016|gb|AAW47269.1| (Nramp metal transporter-like protein [Noccaea caerulescens]) HSP 1 Score: 82.4 bits (202), Expect = 3.0e-13 Identity = 43/60 (71.67%), Postives = 49/60 (81.67%), Query Frame = -1
BLAST of CU140533 vs. NCBI nr
Match: gi|645220057|ref|XP_008238525.1| (PREDICTED: metal transporter Nramp3 [Prunus mume]) HSP 1 Score: 82.4 bits (202), Expect = 3.0e-13 Identity = 44/60 (73.33%), Postives = 48/60 (80.00%), Query Frame = -1
BLAST of CU140533 vs. NCBI nr
Match: gi|595823396|ref|XP_007205063.1| (hypothetical protein PRUPE_ppa004490mg [Prunus persica]) HSP 1 Score: 82.4 bits (202), Expect = 3.0e-13 Identity = 44/60 (73.33%), Postives = 48/60 (80.00%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|