CU140011 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTCTGATCCTTTGTGGTGACAGAATCAGTATGTGTGTCTGAGCCTGGAACTGCTGCACAATCAGGTTCCATCACCTGAACCTGAGCAGGATGTTTTTCTACATCGGATTCTATATCCTGCTCTTGTGTGTCAAAATTGGGTATTTTCTCCTGCTCCTGGTTAGTGGAATCGTGATTAGCTTGCAATTCTTGCTCGTGATCAGATTGTGCATCCTGCTCATGGG
BLAST of CU140011 vs. TrEMBL
Match: A0A0A0KQ10_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G175900 PE=4 SV=1) HSP 1 Score: 154.8 bits (390), Expect = 4.0e-35 Identity = 73/74 (98.65%), Postives = 73/74 (98.65%), Query Frame = -3
BLAST of CU140011 vs. NCBI nr
Match: gi|778700771|ref|XP_011654914.1| (PREDICTED: uncharacterized protein LOC101204371 [Cucumis sativus]) HSP 1 Score: 139.8 bits (351), Expect = 1.9e-30 Identity = 73/74 (98.65%), Postives = 73/74 (98.65%), Query Frame = -3
BLAST of CU140011 vs. NCBI nr
Match: gi|700195290|gb|KGN50467.1| (hypothetical protein Csa_5G175900 [Cucumis sativus]) HSP 1 Score: 139.8 bits (351), Expect = 1.9e-30 Identity = 73/74 (98.65%), Postives = 73/74 (98.65%), Query Frame = -3
BLAST of CU140011 vs. NCBI nr
Match: gi|659090134|ref|XP_008445855.1| (PREDICTED: uncharacterized protein LOC103488747 isoform X2 [Cucumis melo]) HSP 1 Score: 103.6 bits (257), Expect = 1.5e-19 Identity = 58/73 (79.45%), Postives = 60/73 (82.19%), Query Frame = -3
BLAST of CU140011 vs. NCBI nr
Match: gi|659090132|ref|XP_008445854.1| (PREDICTED: uncharacterized protein LOC103488747 isoform X1 [Cucumis melo]) HSP 1 Score: 103.6 bits (257), Expect = 1.5e-19 Identity = 58/73 (79.45%), Postives = 60/73 (82.19%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|