CU139878 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTTGAGCCGGAGAGTCTGAATTTCACAAGAAGGTATGAAAAGGTTTCTTATAGAATAACTTTTGTGACGAAGAAGAGACAGAGCATGCCAGAATTTGGAGGGTTGATTTGGAAGGATGGAAGTCATAAAGTGAGAAGCCCCATTGTGATTACTTGGTTGTCGTTTGTTTGAATTTCAGTTATACGTTTGGTGATCAATCCTCAAAAGTTGCTTCGTTTTTGTAAGAATTATTTCGTTG
BLAST of CU139878 vs. Swiss-Prot
Match: SBT13_ARATH (Subtilisin-like protease SBT1.3 OS=Arabidopsis thaliana GN=SBT1.3 PE=2 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 4.5e-14 Identity = 31/53 (58.49%), Postives = 42/53 (79.25%), Query Frame = 1
BLAST of CU139878 vs. Swiss-Prot
Match: SBT18_ARATH (Subtilisin-like protease SBT1.8 OS=Arabidopsis thaliana GN=SBT1.8 PE=2 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 5.9e-06 Identity = 25/58 (43.10%), Postives = 32/58 (55.17%), Query Frame = 1
BLAST of CU139878 vs. TrEMBL
Match: A0A0A0LB64_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G178520 PE=4 SV=1) HSP 1 Score: 118.2 bits (295), Expect = 4.4e-24 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 1
BLAST of CU139878 vs. TrEMBL
Match: B9I4H9_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0012s14140g PE=4 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 7.5e-16 Identity = 39/54 (72.22%), Postives = 48/54 (88.89%), Query Frame = 1
BLAST of CU139878 vs. TrEMBL
Match: A0A061G0C3_THECC (Subtilase 1.3 OS=Theobroma cacao GN=TCM_015025 PE=4 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 1.7e-15 Identity = 38/53 (71.70%), Postives = 48/53 (90.57%), Query Frame = 1
BLAST of CU139878 vs. TrEMBL
Match: B9ICZ0_POPTR (Subtilase family protein OS=Populus trichocarpa GN=POPTR_0015s14110g PE=4 SV=2) HSP 1 Score: 88.6 bits (218), Expect = 3.7e-15 Identity = 37/54 (68.52%), Postives = 48/54 (88.89%), Query Frame = 1
BLAST of CU139878 vs. TrEMBL
Match: A0A0L9U0V1_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan02g218400 PE=4 SV=1) HSP 1 Score: 88.6 bits (218), Expect = 3.7e-15 Identity = 37/54 (68.52%), Postives = 50/54 (92.59%), Query Frame = 1
BLAST of CU139878 vs. NCBI nr
Match: gi|778679387|ref|XP_004148149.2| (PREDICTED: subtilisin-like protease SBT1.7 [Cucumis sativus]) HSP 1 Score: 119.4 bits (298), Expect = 2.8e-24 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 1
BLAST of CU139878 vs. NCBI nr
Match: gi|659077296|ref|XP_008439131.1| (PREDICTED: subtilisin-like protease [Cucumis melo]) HSP 1 Score: 114.4 bits (285), Expect = 9.1e-23 Identity = 53/56 (94.64%), Postives = 55/56 (98.21%), Query Frame = 1
BLAST of CU139878 vs. NCBI nr
Match: gi|1021521536|ref|XP_016204155.1| (PREDICTED: subtilisin-like protease SBT1.3 [Arachis ipaensis]) HSP 1 Score: 93.6 bits (231), Expect = 1.7e-16 Identity = 38/54 (70.37%), Postives = 48/54 (88.89%), Query Frame = 1
BLAST of CU139878 vs. NCBI nr
Match: gi|224122532|ref|XP_002318860.1| (hypothetical protein POPTR_0012s14140g [Populus trichocarpa]) HSP 1 Score: 92.0 bits (227), Expect = 4.9e-16 Identity = 39/54 (72.22%), Postives = 48/54 (88.89%), Query Frame = 1
BLAST of CU139878 vs. NCBI nr
Match: gi|743856790|ref|XP_011030007.1| (PREDICTED: subtilisin-like protease [Populus euphratica]) HSP 1 Score: 91.3 bits (225), Expect = 8.3e-16 Identity = 39/54 (72.22%), Postives = 47/54 (87.04%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|