CU139845 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCCAGAGGTTCCCTTACCCAACACTTCTGCTGAAGCCCTCAACAAATCCTCCAAATCAAAAACCCCTAGCTGTATTGTCGAAGAATACCAACTTTTTTACTACATCGATGTTTTCATTTGCTTCCTCTTTCTTATTCTGTACCATTGCCGTAGTAGCAGCTATGGACTGAGGATTTTCGTAAGTCACTTTTTCCTTCGTATATTATCAAGGGT
BLAST of CU139845 vs. TrEMBL
Match: A0A0A0LPW5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G031200 PE=4 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 6.3e-14 Identity = 41/43 (95.35%), Postives = 42/43 (97.67%), Query Frame = -3
BLAST of CU139845 vs. TrEMBL
Match: A0A0A0LPW5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G031200 PE=4 SV=1) HSP 1 Score: 41.2 bits (95), Expect = 6.2e-01 Identity = 20/21 (95.24%), Postives = 20/21 (95.24%), Query Frame = -1
BLAST of CU139845 vs. NCBI nr
Match: gi|778656694|ref|XP_004137566.2| (PREDICTED: probable inactive receptor kinase RLK902 [Cucumis sativus]) HSP 1 Score: 83.6 bits (205), Expect = 1.5e-13 Identity = 41/43 (95.35%), Postives = 42/43 (97.67%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|