CU139342 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGGATTTGATGCATTCAACTAAGTTTAAAATCGGGAAAAGGGTTTGAAGGGAAGAATGTGTTGGTTGTTGGGTCGGGAAATTCAGGGATGGAAATTGCTTTGGATCTTTGTCTTCATGCTGCTAATACTTCTGTTCTTGTTCGAAGCCCGGTGCATTTCATGTCGAAAGGAATGATGACGTTGGGATTGGATATGTTGAAGTACAATTTGCCAATTTTGGTTTGTGGATTCAT
BLAST of CU139342 vs. Swiss-Prot
Match: YUC10_ARATH (Probable indole-3-pyruvate monooxygenase YUCCA10 OS=Arabidopsis thaliana GN=YUC10 PE=2 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 2.9e-13 Identity = 34/59 (57.63%), Postives = 45/59 (76.27%), Query Frame = 2
BLAST of CU139342 vs. Swiss-Prot
Match: YUC3_ARATH (Probable indole-3-pyruvate monooxygenase YUCCA3 OS=Arabidopsis thaliana GN=YUC3 PE=2 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 3.9e-10 Identity = 34/64 (53.12%), Postives = 41/64 (64.06%), Query Frame = 2
BLAST of CU139342 vs. Swiss-Prot
Match: YUC11_ARATH (Probable indole-3-pyruvate monooxygenase YUCCA11 OS=Arabidopsis thaliana GN=YUC11 PE=2 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 6.6e-10 Identity = 30/59 (50.85%), Postives = 43/59 (72.88%), Query Frame = 2
BLAST of CU139342 vs. Swiss-Prot
Match: YUC7_ARATH (Probable indole-3-pyruvate monooxygenase YUCCA7 OS=Arabidopsis thaliana GN=YUC7 PE=2 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 1.9e-09 Identity = 32/64 (50.00%), Postives = 41/64 (64.06%), Query Frame = 2
BLAST of CU139342 vs. Swiss-Prot
Match: YUC9_ARATH (Probable indole-3-pyruvate monooxygenase YUCCA9 OS=Arabidopsis thaliana GN=YUC9 PE=2 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 3.3e-09 Identity = 32/60 (53.33%), Postives = 40/60 (66.67%), Query Frame = 2
BLAST of CU139342 vs. TrEMBL
Match: A0A0A0L6W1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G190380 PE=4 SV=1) HSP 1 Score: 128.3 bits (321), Expect = 4.2e-27 Identity = 63/63 (100.00%), Postives = 63/63 (100.00%), Query Frame = 2
BLAST of CU139342 vs. TrEMBL
Match: A0A0L9UAE6_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan03g289400 PE=4 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 2.8e-15 Identity = 43/59 (72.88%), Postives = 52/59 (88.14%), Query Frame = 2
BLAST of CU139342 vs. TrEMBL
Match: V7CXX6_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_001G202100g PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 1.1e-14 Identity = 43/58 (74.14%), Postives = 50/58 (86.21%), Query Frame = 2
BLAST of CU139342 vs. TrEMBL
Match: M5VJ66_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa007054mg PE=4 SV=1) HSP 1 Score: 86.7 bits (213), Expect = 1.4e-14 Identity = 42/59 (71.19%), Postives = 49/59 (83.05%), Query Frame = 2
BLAST of CU139342 vs. TrEMBL
Match: A0A0B0PVY0_GOSAR (Flavin-containing monooxygenase YUCCA10-like protein OS=Gossypium arboreum GN=F383_09630 PE=4 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 5.3e-14 Identity = 40/59 (67.80%), Postives = 49/59 (83.05%), Query Frame = 2
BLAST of CU139342 vs. NCBI nr
Match: gi|778679924|ref|XP_011651215.1| (PREDICTED: probable indole-3-pyruvate monooxygenase YUCCA10 [Cucumis sativus]) HSP 1 Score: 128.3 bits (321), Expect = 6.0e-27 Identity = 63/63 (100.00%), Postives = 63/63 (100.00%), Query Frame = 2
BLAST of CU139342 vs. NCBI nr
Match: gi|659123221|ref|XP_008461553.1| (PREDICTED: probable indole-3-pyruvate monooxygenase YUCCA10 [Cucumis melo]) HSP 1 Score: 116.3 bits (290), Expect = 2.3e-23 Identity = 56/63 (88.89%), Postives = 61/63 (96.83%), Query Frame = 2
BLAST of CU139342 vs. NCBI nr
Match: gi|920696287|gb|KOM39512.1| (hypothetical protein LR48_Vigan03g289400 [Vigna angularis]) HSP 1 Score: 88.6 bits (218), Expect = 5.2e-15 Identity = 43/59 (72.88%), Postives = 52/59 (88.14%), Query Frame = 2
BLAST of CU139342 vs. NCBI nr
Match: gi|950950596|ref|XP_014495430.1| (PREDICTED: probable indole-3-pyruvate monooxygenase YUCCA10 [Vigna radiata var. radiata]) HSP 1 Score: 88.2 bits (217), Expect = 6.8e-15 Identity = 43/59 (72.88%), Postives = 52/59 (88.14%), Query Frame = 2
BLAST of CU139342 vs. NCBI nr
Match: gi|645258651|ref|XP_008234984.1| (PREDICTED: probable indole-3-pyruvate monooxygenase YUCCA10 [Prunus mume]) HSP 1 Score: 86.7 bits (213), Expect = 2.0e-14 Identity = 42/59 (71.19%), Postives = 50/59 (84.75%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|