CU139026 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTTTTCCCCATGATGGTACGGCCCAAACGAAACCATGTGTGGCATGTACGCTTCCTTATGGACATCTTTAATGAAGTTTGGTATTTTGTAAATCGAAGGTTTGATGGTTTTTCCTGATGATCCCAACTTCTCCACAGCTACTGATTTCATCAGCAGTTTTCTTCAGATTGTCTTTGACTTCAACTACCACGGCATTGTCCATTATTGGTAATTGATCTTTATGATCAGTTGATCTGCAATAGATGGGCAGCA
BLAST of CU139026 vs. TrEMBL
Match: A0A0A0K9F5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G089270 PE=4 SV=1) HSP 1 Score: 113.6 bits (283), Expect = 1.2e-22 Identity = 53/54 (98.15%), Postives = 54/54 (100.00%), Query Frame = -1
BLAST of CU139026 vs. TrEMBL
Match: A0A0A0K9F5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G089270 PE=4 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 9.4e-09 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = -3
HSP 2 Score: 77.0 bits (188), Expect = 1.2e-11 Identity = 34/53 (64.15%), Postives = 41/53 (77.36%), Query Frame = -1
BLAST of CU139026 vs. TrEMBL
Match: A0A0A0KDE1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G090770 PE=4 SV=1) HSP 1 Score: 39.7 bits (91), Expect = 2.1e+00 Identity = 20/43 (46.51%), Postives = 28/43 (65.12%), Query Frame = -3
HSP 2 Score: 70.5 bits (171), Expect = 1.1e-09 Identity = 34/53 (64.15%), Postives = 42/53 (79.25%), Query Frame = -1
BLAST of CU139026 vs. TrEMBL
Match: E5GB49_CUCME (Putative uncharacterized protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 35.0 bits (79), Expect = 5.2e+01 Identity = 18/31 (58.06%), Postives = 22/31 (70.97%), Query Frame = -3
HSP 2 Score: 58.5 bits (140), Expect = 4.4e-06 Identity = 22/34 (64.71%), Postives = 30/34 (88.24%), Query Frame = -1
BLAST of CU139026 vs. TrEMBL
Match: A0A059AM69_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_I00809 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 4.4e-06 Identity = 22/34 (64.71%), Postives = 30/34 (88.24%), Query Frame = -1
BLAST of CU139026 vs. NCBI nr
Match: gi|700191196|gb|KGN46400.1| (hypothetical protein Csa_6G089270 [Cucumis sativus]) HSP 1 Score: 113.2 bits (282), Expect = 2.2e-22 Identity = 53/54 (98.15%), Postives = 54/54 (100.00%), Query Frame = -1
BLAST of CU139026 vs. NCBI nr
Match: gi|700191198|gb|KGN46402.1| (hypothetical protein Csa_6G090770 [Cucumis sativus]) HSP 1 Score: 76.6 bits (187), Expect = 2.2e-11 Identity = 34/53 (64.15%), Postives = 41/53 (77.36%), Query Frame = -1
BLAST of CU139026 vs. NCBI nr
Match: gi|307135819|gb|ADN33691.1| (hypothetical protein [Cucumis melo subsp. melo]) HSP 1 Score: 70.1 bits (170), Expect = 2.1e-09 Identity = 34/53 (64.15%), Postives = 42/53 (79.25%), Query Frame = -1
BLAST of CU139026 vs. NCBI nr
Match: gi|659120434|ref|XP_008460192.1| (PREDICTED: uncharacterized protein LOC103499077 [Cucumis melo]) HSP 1 Score: 70.1 bits (170), Expect = 2.1e-09 Identity = 34/53 (64.15%), Postives = 42/53 (79.25%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|