CU138585 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCCTAGATCTCAAAGATCCACATTGCATTTGGTATTCTCAAAAGTTCTAGTATCATTGATTCTTAGCAGGAGATTATTACAATAGATTAGGAGCAACCGAGGTCTCGATGTCCAGTGCTCGACACTATAGCTGATTTCAGCAGAGAAGTGAAGCTCTGGATTTATCTCTTCTTGGTGCCCG
BLAST of CU138585 vs. TrEMBL
Match: A0A0A0LVK9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G132770 PE=4 SV=1) HSP 1 Score: 86.3 bits (212), Expect = 1.4e-14 Identity = 41/56 (73.21%), Postives = 41/56 (73.21%), Query Frame = -2
BLAST of CU138585 vs. TrEMBL
Match: A0A0A0LY09_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G132760 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 3.1e-06 Identity = 26/55 (47.27%), Postives = 33/55 (60.00%), Query Frame = -2
BLAST of CU138585 vs. NCBI nr
Match: gi|778664980|ref|XP_011648454.1| (PREDICTED: uncharacterized protein LOC105434469 [Cucumis sativus]) HSP 1 Score: 86.3 bits (212), Expect = 2.0e-14 Identity = 41/56 (73.21%), Postives = 41/56 (73.21%), Query Frame = -2
BLAST of CU138585 vs. NCBI nr
Match: gi|659071873|ref|XP_008462337.1| (PREDICTED: uncharacterized protein At1g08160-like [Cucumis melo]) HSP 1 Score: 82.0 bits (201), Expect = 3.8e-13 Identity = 39/56 (69.64%), Postives = 40/56 (71.43%), Query Frame = -2
BLAST of CU138585 vs. NCBI nr
Match: gi|659071875|ref|XP_008462348.1| (PREDICTED: protein YLS9-like [Cucumis melo]) HSP 1 Score: 63.9 bits (154), Expect = 1.1e-07 Identity = 30/56 (53.57%), Postives = 35/56 (62.50%), Query Frame = -2
BLAST of CU138585 vs. NCBI nr
Match: gi|778659286|ref|XP_011654134.1| (PREDICTED: protein YLS9-like isoform X2 [Cucumis sativus]) HSP 1 Score: 58.5 bits (140), Expect = 4.5e-06 Identity = 26/55 (47.27%), Postives = 33/55 (60.00%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|