CU138343 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AATCAAAAGTTCAAGTTTATAAATATCCATCGTGGCCAAATGTTCCTTCAACTCAAACAACAAACAGATTCAATAGAAGTTCGCTAGGATTGCTAAAAACTTCCCTCTTTCTAATTCAAAACCATGGCTGTTTTCAACAGTTGCTTGAAGTTCTTATTAATCGTATCCTTGTCATTGGCAAGCATCAACATGAACTTTGCTAGTTCTCGTCGCCTT
BLAST of CU138343 vs. TrEMBL
Match: A0A0A0KLS6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G499075 PE=4 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 2.8e-09 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -2
BLAST of CU138343 vs. TrEMBL
Match: A0A0A0KJZ2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G499070 PE=4 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 7.6e-07 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of CU138343 vs. NCBI nr
Match: gi|700193507|gb|KGN48711.1| (hypothetical protein Csa_6G499075 [Cucumis sativus]) HSP 1 Score: 68.6 bits (166), Expect = 5.2e-09 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -2
BLAST of CU138343 vs. NCBI nr
Match: gi|700193508|gb|KGN48712.1| (hypothetical protein Csa_6G499070 [Cucumis sativus]) HSP 1 Score: 58.5 bits (140), Expect = 5.4e-06 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of CU138343 vs. NCBI nr
Match: gi|659081034|ref|XP_008441114.1| (PREDICTED: rRNA 2'-O-methyltransferase fibrillarin-like [Cucumis melo]) HSP 1 Score: 57.8 bits (138), Expect = 9.1e-06 Identity = 29/34 (85.29%), Postives = 29/34 (85.29%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|